Mice, cell lines, antibody information, and drug treatment
Male adult C57BL/6 mice (8 weeks old, 20–25 g each, Guangdong Experimental Animal Center), CD1 mice (14 weeks old, 40–45 g each, Guangdong Experimental Animal Center), and male adult Thy1-Yellow fluorescent protein (YFP) mice were used in experiments. The animals were housed under controlled temperature and kept on a 12-h light/dark cycle (lights on between 07:00 and 19:00), with ad libitum access to food and water. The protocol was approved by the Jinan University Institutional Animal Care and Use Committee. All experiments were carried out following the Guide for Animal Experimentation of Jinan University. HEK293 or BV2 cells were cultured in high-glucose Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (Excell Bio.) and penicillin (100 units/mL)–streptomycin (100 μg/mL) (all from Hyclone). Cells were incubated at 37 °C in a humidified incubator containing 5% CO2. The following antibodies were used for experiments Nrf2 (ab137550), MeCP2 (ab2828), BDNF (ab108319), CD11b (Invitrogen 13-0112-82), iNOS (Invitrogen PA3-030A) and CD206 (MYBIOSOURCE MBS215669). The beta-actin antibody was purchased from EarthOx.
Lipopolysaccharide (LPS, 1 μg/ml for BV2 cell; L-4130, serotype 0111:B4, Sigma-Aldrich). SFN (10 mg/kg; MedChemExpress, Shanghai, China) was dissolved in distilled water containing 10% corn oil. SFN (10 mg/kg) was administered intraperitoneally (i.p.) to mice before the social defeat stress 30 min for 10 days. The dose of LPS and SFN was selected as previously reported [8, 26].
Chronic social defeat stress (CSDS)
For the CSDS depression model, the C57BL/6 mice were defeated by differently CD1 mice for 10 min total of 10 days. After the social defeat session, the CD1 mouse and C57BL/6 mice or Thy1-YFP mice were housed in the half cage that separated by using a perforated Plexiglas divider, which can allow visual, olfactory, and auditory contact in the 24 hours. The C57BL/6 mice or Thy1-YFP mice have raised separately after finish the last session of social defeat. The social interaction test was performed to test the mice that were susceptible and unsusceptible.
For the social interaction test, an open box (42 × 42 cm) was used, which has an interaction zone including a mesh-plastic target box (10 × 4.5 cm) and two opposing corner zones. The two parts were used for this test (no social target and social target). For the no social target, the test mouse was placed into an open field arena for 2.5 min with no social target (no CD1 mouse) in the mesh-plastic target box. After no social target test, the mouse was placed into the open field arena again in the second 2.5 min with a social target (a novel CD1 mouse) in the mesh-plastic target box. The residence time in the interaction zone was counted by using the stopwatch, the time of ratio for social target, and no social target was calculated. About 70% of mice were susceptible after social defeat stress.
Sucrose preference test
The mice were habituated to a 1% sucrose solution for 48 h before the test day. And then the mice were deprived of water and food for 4 h, followed by a preference test with water and 1% sucrose for 1 h. The bottles containing water and sucrose were weighed before and at the end of this period and the sucrose preference (%) was determined.
Luciferase assay
HEK293 cells were transfected with BDNF exon I, II and IV luciferase reporter together in 6-wells plates, pRL-TK Renilla luciferase plasmid (Promega), and different kinds of drugs, plasmids, or siRNA., the cells were collected and subjected to the dual-luciferase reporter assay kit (Promega) according to the manual after following transfection for 24 h.
Chromatin immunoprecipitation (ChIP) assay
The cells were subjected to the ChIP assay protocol in the manual of the SimpleChIP® Enzymatic Chromatin IP Kit (Cell signaling), after transfection or treatment with certain plasmids or drugs. In the Chip assay, 7.5 μg of Nrf2 antibody (Abcam) was added to the homogenate for the sample. In the PCR analysis, the BDNF exon I specific primers were used for the amplification of the promoter region. The primer sequences were: forward 5’ GGCTTCTGTGTGCGTGAATTTGC 3’; reverse 5’ AAAGTGGGTGGGAGTCCACGAG’. The PCR sample was resolved on a 2% agarose gel and sequenced after 35 cycles of PCR (denature at 95°C for 30 s, anneal at 58°C for 30 s, and extend for 30 s at 72°C).
Immunofluorescence staining
The mice were anesthetized with sodium pentobarbital and perfused transcardially with 10 ml of isotonic saline, followed by 40 ml of ice-cold 4% paraformaldehyde in 0.1-M phosphate buffer (pH 7.4). The brain samples were collected after perfused and postfixed overnight at 4°C. The 50-μm thick serial coronal sections of brain tissue were cut in ice-cold, 0.01-M phosphate-buffered saline (pH 7.5), using a vibrating blade microtome (VT1000S, Leica Microsystems AG, Wetzlar, Germany). For the staining, the cells or mice brain sections were incubated with 3% hydrogen peroxide at room temperature for 10 minutes after the following fixing by 4% paraformaldehyde-fixed. And then the sections were blocked by a blocking solution for 1h and incubated with primary antibodies overnight. The next day, the Alexa Fluor 488 or 568 conjugated isotype-specific secondary antibody was incubated for 1 h at room temperature. Images were then collected with an Olympus confocal microscope. The fluorescence intensity was quantified using Fiji/Image J.
Enzyme-linked immunosorbent assay
The blood samples were obtained via a cardiac puncture on 13 days after CSDS. The serum samples were obtained from blood by using centrifuging at 2000 g for 20 min.
blood was centrifuged at 2000×g for 20 min to generate serum samples. The serum samples were diluted 10-fold with ELISA (enzyme-linked immunosorbent assay) diluent solution. The serum levels of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), interleukin-10 (IL-10) and interleukin-4 (IL-4) were measured using a Ready-SET-Go ELISA kit (eBioscience) according to the manufacturer’s instructions.
Western blotting assay
The cell and mice brain sample was lysed in RIPA buffer (20 mM pH 7.5 Tris-HCl, 150 mM NaCl, 1 mM Na2EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM beta-glycerophosphate, 1 mM Na3VO4, 1 μg/ml leupeptin, 1 mM phenylmethylsulfonyl fluoride) on ice for 30 min. Cell lysates or brain lysates were then centrifuged at 13,000×g for 30 min at 4 °C. The supernatant was collected, and protein concentration was determined using a Coomassie Brilliant Blue protein assay kit (Bio-Rad). The same amount of the supernatant was boiled in SDS loading buffer. After SDS-PAGE, the samples were transferred to a polyvinylidenedifluoride (PVDF) membrane. The membranes were blocked in 2% BSA for 1h at room temperature and then incubated with the primary antibody (The concentration is selected with the manufacturer’s instructions) at 4 °C overnight. The next day, the blots were incubated with an anti-mouse (1:5000) or anti-rabbit (1:5000) secondary antibody. Images were captured with a Tanon-5200CE imaging system (Tanon, Shanghai, China), and immunoreactive bands were quantified.
Dendritic spine analysis
After the social interaction test, the Thy1-YFP mice were deeply anesthetized with sodium pentobarbital and perfused transcardially with 10 ml of isotonic saline, followed by 40 ml of ice-cold 4% paraformaldehyde in 0.1-M phosphate buffer (pH 7.4). Brains were removed from the skulls and postfixed overnight at 4°C. For dendritic spine analysis, 50-μm thick serial coronal sections of brain tissue were cut in ice-cold, 0.01-M phosphate-buffered saline (pH 7.5), using a vibrating blade microtome (VT1000S, Leica Microsystems AG, Wetzlar, Germany). The sections were mounted on gelatinized slides, dehydrated, cleared, and coverslipped under Permount® (Fisher Scientific, Fair Lawn, NJ, USA). Next, sections were imaged, and dendritic spine density was quantified in 10 μm of each dendritic in a blinded manner.
Statistical analysis
The data are shown as the mean ± standard error of the mean (S.E.M.). The data were analyzed using PASW Statistics 20 (formerly SPSS statistics; SPSS). All data were analyzed using a one-way analysis of variance (ANOVA), followed by the post hoc Fisher LSD test. P values < 0.05 were considered statistically significant.