Authentication, extraction and quality control of EXD
Six herbal medicines used in EXD, including HEP, XM, BJT, ZM, HB, and DG at a ratio of (9:9:9:6:6:9) were purchased from mainland China and authenticated by High-performance liquid chromatography (HPLC) assays. HPLC was conducted to ensure that these herbs' quality fulfills the requirement of the China Pharmacopoeia and/or the Hong Kong Chinese Materia Medica Standard. Upon authentication, herbs were delivered to Xi’an Pincredit Bio-tech Co., Ltd for water extract preparation as descripted previously [11]. The quantities of chemical markers in EXD extract was determined by Liquid chromatography–mass spectrometry (LC-MS).
Experimental design and animal treatment
The animal experiment protocol was approved by the Hong Kong Polytechnic University Animal Subjects Ethics Sub-committee (ASESC Case: 15-16/31-ABCT-HMRF). Eighty six-month-old female Sprague Dawley (SD) rats were given OVX or sham operation. Upon two-week recovery, the OVX rats were orally administrated with vehicle, 17ß-estradiol (E2, 1.0 mg/kg.day), tamoxifen (1.0 mg/kg.day), raloxifene (3.0 mg/kg.day), EXD (1.6 g/kg.day) or its combinations with tamoxifen (EXD+Tamo) and raloxifene (EXD+Ralo) for 12 weeks (n=10/group). Sham-operated rats treated with vehicle were used as control. Dosages of E2, tamoxifen, raloxifene, and EXD were chosen based on equivalent human dosages and/or previous preclinical studies [11, 13]. During the whole treatment, the animals were pair-fed with phytoestrogen-free diet (AIN-93M, Research diet, New Jersey, USA) to remove the influence of phytoestrogens in the diet. Bodyweight was measured every two weeks. Urine, serum and uterus were collected and stored at -80℃ for further detection. The left leg and lumbar spine were collected for micro-CT analysis. Sample size (n = 10/group) was determined at alpha of 5 % and power of 90 % based on our previous data of serum osteocalcin in rats (1 % suppression) [14].
Biochemical analysis of serum and urine
Calcium (Ca) and phosphorus (P) level in serum and urine as well as urinary level of creatinine were measured by Arsenazo III UV (Shanghai Kehua Bio-Engineering Co. LTD, Shanghai, China) with Hitachi 7100 automatic biochemical analyzer. Urinary deoxypyridinoline (DPD) was determined by enzyme-linked immunosorbent assay (ELISA) kit (QUIDEL, San Diego, USA) and normalized by urinary creatinine. Serum level of osteocalcin (OCN, Alfa Aesar, Massachusetts, USA), estradiol (Alfa Aesar, Massachusetts, USA), luteinising hormone (LH, CayMan Chemical, Ann Arbor, USA), and follicle-stimulating hormone (FSH, Cloud-Clone Corp., Texas, USA) were measured by ELISA kit.
BMD and Micro-CT analysis
Bone properties of trabecular bone at proximal tibia, distal femur and lumbar vertebra (L4) were determined by Micro-computed tomography (Micro-CT, μCT40, Scanco Medical, Switzerland). The source energy selected was 70 KVp and 114 μA, with a resolution of 21 μm. Approximately 200 slices were done for each scan. The distal/proximal were defined as 4.2 mm and 2.2 mm away from the femur/tibia head. Scanning was done at the metaphyseal area located 0.63 mm below the lowest point of the epiphyseal growth plate and extending 2.0 mm in the proximal direction. Bone mineral density (BMD, mg HA/ccm2) and bone morphometric properties, including bone volume over total volume (BV/TV), connectivity density (Conn.D, 1/mm3), structure model index (SMI), trabecular bone number (Tb.N, mm-1), trabecular bone thickness (Tb.Th, mm) and trabecular bone separation (Tb.Sp, mm), were evaluated by contoured volume of interest (VOI) images.
Hematoxylin-eosin staining
The morphological change of uterus was examined by Hematoxylin-eosin staining (H&E). Uterus samples were collected and fixed in 4% paraformaldehyde for 6 hours. After dehydration (Leica TP1020, Leica biosystem, Buffalo Grove, USA), tissues were embedded in paraffin. Sections for histology were cut at 5 microns from the paraffin blocks using a standard microtome (Leica biosystem, Buffalo Grove, USA) before mounting and heat-fixed on glass slides. Standard H&E staining was performed. A minimum of 5 sections from each sample were observed using 400× magnification and photographed using a photoscope (Olympus BX51, Olympus corporation, Tokyo, Japan)
Real-time PCR
The mRNA expression histone H3, a marker of proliferation for endometrium, was measured in rat uterus. Total RNA was isolated from the uterus of rats in Trizol reagent (Thermofisher, MA, USA) by using Precellys 24 homogenizer (Bertin Technologies SAS, France). RNA was reverse-transcribed into cDNA by using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems, MA, USA) in Veriti™ 96-Well Thermal Cycler (Applied Biosystems, MA, USA). The specific primer for histone H3 and GAPDH (histone H3 forward 5' CTACCAGAAGTCGACCGAGC 3' , reverse 5' TCCTTGGGCATGATGGTGAC 3' ; GAPDH forward 5' CAAGTTCAACGGCACA
GTCAAGG 3'; reverse 5' ACATACTCAGCACCAGCATCACC 3') were used to perform RT-PCR with TB Green detection (TaKaRa Bio, Kyoto, Japan) using QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, MA, USA). For each gene, a standard curve was established to determine the relative quantity of mRNA, and the melting curve was used to assess the specificity of the amplification.
Preparation of EXD-treated serum
The metabolites of TCM usually considered as the functional component, which require biological activation. To observe the direct estrogenic actions of EXD in vitro, EXD-treated serum (EXD-Ts), a biologically activated form of EXD, were prepared in OVX rats. OVX rats were given vehicle or EXD at 16.0 g/kg.day (n=10/group) for three consecutive days and pair-fed with phytoestrogen-free diet. Upon the last oral administration on day 3, the rats were fasted overnight and given drugs one more time in the following morning. Rats were then sacrificed after an hour, and serum was prepared and stored at -80oC. LC-MS analysis of the serum was performed to confirm the presence of major chemical markers from each herb. Methanol extract of serum was prepared, and extract of 1ml serum was dissolved in 1ml of ethanol, and the concentration of this solution was defined as "1". MicrosepTM Advance Centrifugal Device (3K, Pall Corporation, NY, USA) was used to remove small molecules, including steroids in serum extract, and the solution was sterilized with 0.22 μm membrane. The final dilution (10-5, 10-4, 10-3, and 10-2) of the serum extract (EXD-Ts) was used for cell studies.
Cell culture and ALP assay
Human osteosarcoma MG-63 cell (ATCC® CRL-1427TM) was cultured in dulbecco’s modified eagle’s medium (DMEM, Gibco, MA, USA) supplemented with 100 U/ml penicillin, 100ug/ml streptomycin (Invitrogen, MA, USA), and 10% Fetal Bovine Serum (FBS, Gibco, MA, USA). The cultures were maintained in an incubator at 37℃ in a 97% humidified atmosphere of 5% CO2. Cells were cultured with phenol red-free (PRF) medium containing 5% charcoal-stripped fetal bovine serum (cs-FBS) 24 hours before subjecting to treatment with vehicle, E2 (10-8 M), crude EXD extract (1-200 μg/ml), EXD-Ts (10-4-10-2 dilution), tamoxifen (10-12 to 10-6 M), raloxifene (10-12 to 10-6 M) or their combinations with EXD-Ts at the optimal concentration in PRF medium for 48 h. Upon treatment, 100 μl of Passive Lysis Buffer was added to each well to lyse cell. The ALP activity of cell lysate was measured by a LabAssayTM ALP kit (Wako, Osaka, Japan) following the manufacturer's instruction.
Statistical analysis
Data were reported as mean ± SEM. Inter-group differences of in vivo experiment were analyzed by one-way ANOVA with Tukey's as post hoc test. Inter-group differences in in vitro experiment were analyzed by t-test. Interactions between drugs were analyzed by two-way ANOVA with Bonferroni as a post hoc test. A value of p<0.05 was considered statistically significant. The correlation between serum hormone level and BMD at tibia in rats were analyzed using Pearson’s correlation.