Antibodies and reagents
The antibodies and reagents used in this study are listed with their sources in parentheses as follows: monoclonal antibodies against glyceraldehyde-phosphate dehydrogenase (GAPDH) (ImmunoWay Biotechnology, Texas, USA), polyclonal antibodies against ANGPTL3 (R&D Systems, Minneapolis, USA), and polyclonal antibodies against LPL (Santa Cruz Biotechnology, Santa Cruz, CA). Lipopolysaccharide (LPS) was purchased from Pfizer Inc., USA.
Production of Cas9 mRNA and sgRNA
The T7 promoter was added to the Cas9 coding sequence by polymerase chain reaction (PCR) amplification using the PX330 vector (Addgene) and the primer Cas9 (F and R) (Table S1). The T7-Cas9 PCR product was gel purified by a QIAquick Gel Extraction Kit (Qiagen, USA) and used as the template (500 ng) for in vitro transcription (IVT) using the mMESSAGEmMACHINE T7 ULTRA Transcription Kit (Thermo Fisher Scientific, USA). Both the T7 promoter and targeting sequence were added to sgRNA by PCR amplification using the primer sgAngptl3 (F and R) (Table S1). The T7-sgRNA PCR product was also purified on gels using a QIAquick Gel Extraction Kit (Qiagen, USA) and then used as a template (250 ng) for IVT using a MEGA short script T7 kit (Thermo Fisher Scientific, USA). Both Cas9 mRNA and sgRNA were purified according to the standard protocol by phenol:chloroform extraction and ethanol precipitation and were then dissolved in DNase/RNase-free water (Thermo Fisher Scientific, USA).
Generation of Angptl3-knockout mice
Female C57BL/6 mice (6–8 weeks old) were used as embryo donors. Female C57BL/6 mice were superovulated by intraperitoneal injection with pregnant mare serum gonadotropin (PMSG) and human chorionic gonadotropin (hCG) and then mated with male C57BL/6 mice. Fertilized embryos (zygotes) were collected from the oviducts. Cas9 mRNA (100 ng/μL) and sgRNA (angptl3) (50 ng/μL) were mixed and injected into the cytoplasm of fertilized eggs with both pronuclei visible in CZB (Chatot–Ziomek–Bavister) medium. The injected zygotes were then cultured in Quinn’s Advantage cleavage medium (In Vitro Fertilization, Inc.) at 37 °C and 5% CO2 for approximately 24 h, and 18–20 2-cell stage embryos were transferred into the oviduct of a pseudopregnant ICR female mouse at 0.5 dpc. This work was performed at Shanghai Gemple Biotech Co. Ltd.
Mouse identification and maintenance
Angptl3-/- mice were generated by the clustered regularly interspaced short palindromic repeats-associated protein 9 (CRISPR/Cas9) system. All mice had access to food and water. All experiments were performed in accordance with the Health Guide for the Care and Use of Laboratory Animals and were approved by the Biological Research Ethics Committee of Gansu Province People’s Hospital (No. syll20130331). Genotyping of angptl3-/- mice was performed by PCR analysis of mouse tail-tip genomic DNA using angptl3 primers (F and R) (Table S2) and then analyzed by Sanger sequencing. This work was performed in the Animal Center of Gansu University of Traditional Chinese Medicine. All mice were housed in an air-conditioned room and were provided free access to food and water (22 ± 2 °C; 12:12-hour light:dark cycle). After the mice were anesthetized with 10% chloral hydrate (400 mg/kg), the mice were euthanized by cervical dislocation, and all efforts were undertaken to minimize pain and discomfort. The mice did not exhibit signs of peritonitis after the administration of 10% chloral hydrate (400 mg/kg).
Generation of angptl3-knockout mice
The double-strand breaks (DSBs) induced by the CRISPR/Cas9 system stimulate DNA repair by at least two distinct mechanisms, nonhomologous end joining (NHEJ) and homology-directed repair (HDR). NHEJ is error-prone and introduces unpredictable patterns of insertions and deletions (Indel), which can lead to disruptions in the protein-coding capacity of a defined locus. To generate angptl3-knockout mice, we injected Cas9 mRNA and sgRNA targeting angptl3 exon 1, which contains the start codon, into fertilized eggs (Fig. S1a). Subsequent subcloning of the flanking regions surrounding the sgRNA targeting site identified four founder mice with frameshift mutations (Fig. S1b).
Generation of angptl3 transgenic mice
Murine angptl3 cDNA was synthesized by Shanghai Gemple Biotechnology and cloned into the pcDNA3.1 vector (Fig. S2a). This plasmid, designated pcDNA3.1-Angptl3, was linearized by MluI/DraIII, and the fragment of interest was then purified for oocyte injection into C57Bl/6 mouse-derived fertilized eggs[9-10]. Transgenic mice were identified by PCR using oligonucleotide primers specific for the construct (CMV-F, 5’-CGCGTTGACATTGATTATTGA CTA -3’ and angptl3-R, 5’- CAGGAGGCCATTCG CTAAAA -3’; PCR fragment =892 bp) (Fig. S2b).
Generation of LPS nephrosis in mice
All animal studies were approved by the Subcommittee on Research Animal Care of the Gansu Province People’s Hospital (No. syll20130331) and performed in the Animal Center of Gansu University of Traditional Chinese Medicine. Thirty-six male wild-type or Angptl3-/- C57BL/6 mice 6- to 8-weeks old were given free access to standard laboratory food and water. Both groups of mice were injected intraperitoneally with 200 μg of LPS (1 mg/ml in sterile LPS-free PBS) in a total volume of 200 μl. Mice in the control group (n=5) were intravenously administered an identical volume of saline. After the four groups were injected, urinary protein excretion was measured at 24 hours, 48 hours, and 72 hours, and kidney and liver tissues were harvested and processed for H&E staining. FP effacement was assessed by transmission electron microscopy according to our published protocols[11]. After LPS injection, the mice were killed at 24 h, 48 h, and 72 h, during which time no unexpected deaths were observed. The humane endpoint was defined as weight loss of 20%, dyspnea, or difficulty feeding within 72 hours of LPS injection. Death was confirmed by the absence of a pulse, breathing, corneal reflex, response to toe pinch and a lack of respiratory sounds and heartbeat.
Objectives
In this study, 196 patients with PNS who were admitted to Gansu Province People's Hospital from Jan 2016 to Jan 2018 from china were enrolled, including 124 males and 72 females. The study protocol conformed to the ethical guidelines of the 2013 Declaration of Helsinki. We ensured that all patients and healthy controls provided informed and written consent for the study, and ethics approval was obtained from the Gansu Province People’s Hospital Research Ethics Committee (syll 20160037).
PNS met the inclusion criteria of nephrotic syndrome, with urinary protein > 3.5 g/d and plasma albumin < 30 g/L, accompanied by varying degrees of edema and/or hyperlipidemia[12-13]. The exclusion criteria were as follows: PNS patients without the required clinical and laboratory data, those with secondary nephrotic syndrome, a previous history of other acute or any stage of chronic kidney disease, patients with abnormal ultrasound examination of the urinary system (e.g., deformities, cysts, hydrops, stones), acute or chronic illness (diabetes mellitus, thyroid dysfunction, polycystic ovary syndrome, obesity, fatty liver, familial hypercholesterolemia), and other systemic diseases, such as hematological diseases, cardiovascular diseases, connective tissue diseases, tumors, and obvious infections.
There were 196 patients with PNS included in this study, including 72 females (36.54%) and 124 males (63.46%), with a male-to-female ratio of 1:0.58. The average age of the PNS group was 32(32.88-37.75) and that of the healthy control group was 31.5(29.37-42.83), and there was no significant difference between the two groups (P > 0.05), as shown in Table 1.
Experimental methods
(1) Sample collection: Elbow venous blood (3 ml) was collected from fasting subjects in the morning in an anticoagulant test tube. Serum was separated after centrifugation for 5 minutes (800 x g) and transferred to EP tubes. Five milliliters of urine was collected and placed in a test tube without any additives. After being centrifuged for 5 minutes (800 x g), the supernatant was collected and transferred into EP tubes. Serum and urine were frozen at -80 °C for use.
- Detection of serum and urine biochemical indicators: Biochemical indicators such as triglyceride (TG), total cholesterol (TC), high density lipoprotein (HDL-C), low density lipoprotein (LDL-C), serum creatinine (Scr), urea nitrogen (BUN), and 24-hour urea protein (24 hUP) were measured by an automatic biochemical analyzer (ABBOTT ARCHITECT c1600, USA).
- Determination of ANGPTL3 levels in serum: The concentration of ANGPTL3 in serum was measured by ELISA kits for human ANGPTL3, and the specific protocol was carried out strictly according to the instructions.
Hepatocyte cell line culture and treatment
A nontumorigenic mouse hepatocyte cell line (AML12) was obtained from the American Type Culture Collection (ATCC) and cultured in DMEM/F12 medium (Gibco) containing 5 μg/ml ITS premix (Sigma–Aldrich, USA), 40 ng/ml dexamethasone (Sigma–Aldrich), and 10% fetal bovine serum (FBS, Gibco) at 37 °C in a humidified atmosphere with 5% CO2. Lipopolysaccharide (LPS; working concentration: 25 μg/ml) was purchased from Sigma–Aldrich. AML12 cells were collected after LPS stimulation for 24 h.
Lentiviral infection
To produce ANGPTL3 overexpression or knockdown lentivirus, the lentivirus with the murine angptl3 coding sequence or angptl3 shRNA and blank control were purchased from Gemple Biotechnology (Shanghai, China). The target sequences of angptl3 shRNA were as follows: sh angptl3#1, 5’-GCTGGG TCATGGACTTAAAG-3’; and sh angptl3#2, 5’-GCAGCTAACCAACTTAA TTC-3’. AML12 cells were infected with recombinant lentivirus plus 8 µg/ml polybrene (Sigma–Aldrich) at a multiplicity of infection (MOI) of 20. Stable lentivirus-infected cells were selected and enriched by flow cytometry (BD).
RNA extraction and quantitative RT–PCR
Total RNA was extracted using a Direct-zol RNA MiniPrep kit (Zymo Research, USA) according to the manufacturer's instructions. Total mRNA (1 μg) was reverse transcribed using 5X All-In-One RT MasterMix (Abm, Canada) according to the manufacturer's instructions. Real-time PCR (RT–PCR) was performed using SYBR FAST qPCR Kit Master Mix (2X) Universal (KAPA, USA) on an Applied Biosystems 7,500 Fast RT–PCR System (Foster City, USA). The RT–PCR system involved cDNA (1.0 μl), 2X SYBR‑Green Mix (10 μl), forward primer (10 μM, 0.5 μl), reverse primer (10 μM, 0.5 μl), and RNase‑free water in a final volume of 20 μl. The reaction conditions were as follows: 2 min of denaturation at 94 °C, 40 cycles of 1 min at 94 °C, 30 sec at 56 °C, 2 min at 72 °C, and a final extension step at 72 °C for 10 min. The cycle threshold (Ct) values were analyzed using the comparative Ct (ΔΔCt) method according to the MIQE guidelines. The amount of the target was normalized to an endogenous reference (GAPDH) and is expressed relative to the control (nontreated cells). The primers used were as follows: ANGPTL3 (forward, 5’- GCGAACATACAAGTGGCGTG-3’; reverse, 5’-CTGTGAGCCATCT TTCCGGT-3’); and LPL (forward, 5’- GAAAACCCCAGC AAGGCATAC -3’; reverse, 5’- CATCTTGCTGCTTCTCTTGGC -3’).
Oil Red O Staining
Oil Red O staining was performed with an Oil Red O Stain Kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer's instructions. The results were examined by a light microscope, and the OD560 was measured for quantification.
Western blotting
We performed immunoblotting experiments as described previously[4].
Statistical analysis
The experimental data were tested for normality using the Kolmogorov–Smirnov method, and the chi-square test was performed using Levene's test for variance equations. All quantitative information conforming to a normal distribution is expressed as x±s and was analyzed using independent sample t tests; nonnormally distributed quantitative data are expressed as median and95%CI and were analyzed using the Mann–Whitney U test; and the difference in the sex ratios were tested by the X2 test. Pearson correlation analysis was used to examine correlations between variables of two measures that obeyed normal distribution; the Spearman rank correlation test was used to analyze correlations between variables of two measures that did not obey normal distribution. The values from animals or cells were subjected to one-way ANOVA, and Pearson correlations among the groups were calculated. P values of <0.05 were considered statistically significant. The data were statistically processed using SPSS 20.0 software.