2.1 Study area and sampling
The geological survey of India report (1994) surveys an area of 220 sq. km. of Sakoli basin falling in parts of Nagpur and Bhandara districts for tungsten mineralization. Tungsten mineralization was observed in the north-western part of the proterozoic Sakoli basin. The BRGL-MECL report (1991) has also confirmed the occurrence of tungsten deposits in the Khobna region. Hence Kuhi-Agargaon and Khobana region of the Sakoli basin were selected for soil sampling in this study. Figure 1 and Supplementary Table 1 depict the location details of the sites where the soil was sampled. USEPA standard protocols were followed for sub-sampling of soil and samples were transported and stored at 4ºC for further analysis.
2.2. XRF analysis
Sampled soils were subjected to X-ray fluorescence analysis for estimation of heavy metal concentration in soils. The energy dispersive X-ray fluorescence spectroscopy (XRF) technique was used for the qualitative and quantitative determination of the elemental composition of samples where fluorescence radiation was measured by the detector (http://xrf-spectroscopy.com/). These analyses were performed at the Indian Bureau of Mines (IBM) laboratory, MIDC, Nagpur, India.
2.3. Physical and chemical characterization of Soil
The physical and chemical characteristics of the soil system influence the transformation, retention, and movement of pollutants through the soil. Hence soil characteristics like pH, electrical conductivity, organic carbon, total nitrogen, phosphorus, and potassium content of the soil samples were analysed using standard protocols (Government of Maharashtra, 2009).
2.4. Microbial isolation and identification
Enrichment techniques and serial dilution resulted in isolated bacterial colonies tolerant to tungsten. Bacterial cultures were grown in M9 minimal media with 6 different concentrations of sodium tungstate (5-30 gm/L) with respective controls were incubated at 37°C for 24-48 hrs in an orbital rotator shaker incubator at 120 rpm and checked for visible growth (Jadeja et al., 2019). Cultures in their exponential growth phase were subjected to increasing concentrations of sodium tungstate for 24 hours.
For identification of strains, extraction of total DNA from bacterial cells for PCR analysis was performed by following a simple and rapid CTAB NaCl lysis protocol (Jadeja et al., 2019). Extracted DNA was amplified in Peltier Thermal Cycler and MJ Research Thermal Cycler, with optimal temperatures with thermo cycling program set for 35 cycles. The thermocycling steps include denaturation at 95ºC for 5 minutes and 35 cycles of steps: denaturation at 95ºC for 1 minute, annealing at 55ºC for 1 minute, extension at 72ºC for 1 minute, followed by a final extension at 72ºC for 10 minutes. 16S rDNA gene universal primer with the forward sequence AGAGTTTGATCCTGGCTCAG and reverse sequence AAGGAGGTGATCCAGCCGCA was used in PCR reaction. The PCR product was analysed using horizontal gel electrophoresis systems of standard dimensions from Bangalore Genei with electrophoresis carried out at 100-120 V for 90 min in 1% agarose gel using appropriate dye. The PCR product was sequenced and read in the sequencer with the help of DNA baser software. Sequencing was performed at Triyat Scientific Company. Basic Local Alignment Search Tool search resulted in showing the homologs to the sequences obtained. Phylogenetic tree using closest matches were generated in the MEGA X tool (Kumar et al., 2018).
2.5. Growth curve
Each isolated colony was inoculated in 0.1X LB broth and grown overnight at 120 rpm 37ºC. The next day the cells were harvested by centrifugation, washed with 56 Mm Phosphate buffer and inoculated in 50 ml of M9 medium further incubated at 37°C at 120 rpm in orbital incubator shaker. Absorbance at 600 nm was measured starting from 0 hours to 4 days at the interval of every 8 hours. The growth of isolates was tested in presence of different metals i.e., ammonium metaparatungstate, tungstic acid, cupric nitrate, mercuric chloride, and silver nitrate at different concentrations. All the flask experiments were performed in triplicates.
2.6. Antibiotic susceptibility tests
Antibiotic susceptibility tests were performed by using 24 different antibiotic discs which included ofloxacin (5 µg), nitrofuranoze (100 µg), ciprofloxacillin (30 µg), clindamycin (10 µg), carbenicillin (100 µg), polymyxin b (300 units), fluconazole (10 µg), cefazolin (30 µg), lincomycin (15 µg), amikacin (30 µg), ceftazidime (30 µg), ciprofloxacin (5 µg), cefotaxime (30 µg), nalidixic acid (30 µg), nitrofurantoin (300 units), norfloxacin (30µg), netillin (30 µg), chloramphenicol (30 µg), ampicillin (10 µg), tetracycine (30 µg), gentamycin (10 µg), kanamycin (30 µg), co-trimoxazole (25 µg), streptomycin (10 µg). The sensitivity and resistance profile was determined by the diameter of the zone of inhibition and further evaluation was done according to National Committee for Clinical Laboratory Standard's charts.
2.7. Quantification of tungsten using Inductively Coupled Plasma Mass Spectrometry
To check the extent of the tolerance, bacterial isolates previously tested for metal tolerance were further studied. The isolates that had visible growth in the presence of tungsten were chosen for further analysis. Inductively coupled plasma mass spectrometry (ICP-MS) was used to detect tungsten concentrations. M9 minimal media was prepared to screen for potential tungsten resistant bacterial strains (TRSBs). 1000 ppm of sodium tungstate was supplemented in the media and 500µl bacterial cells of pure isolates (O.D. value = 0.6) were used as inoculums. The tubes were incubated at 37 ± 1ºC on a rotatory shaker at 120 rpm till the development of moderate turbidity. Cultures with sodium tungstate were centrifuged at 8000 rpm at 20ºC for 10 min in sterilized falcon tubes. The supernatant was filtered, and ICP-MS analysis were performed for quantification of tungsten in samples at Anacon Labs, Nagpur.
2.8. Dye decolorization assay
Microbes found tolerant to tungsten were further tested for decolourization of acid orange 7 dye. The dye decolorization experiments were carried out in 100 ml flasks containing 50 ml of minimal M9 media and acid orange 7 dye (100 mg/l). The pH was adjusted to 7 ± 0.2 using sodium hydroxide and hydrochloric acid solution and the cultures were incubated at 37°C for 4 days. Samples were drawn at 24 hours intervals for observation. 10 ml of the dye solution was filtered and centrifuged at 8000 rpm for 20 minutes. Decolorization was assessed by measuring the absorbance of the supernatant with the help of spectrophotometer at wavelength maxima (λm, here 485 nm) of the respective dye (Shah, 2014). Decolourization at different pH ranging from 3,5,7,9,11,13 was studied using tungsten tolerant isolates. The decolorization assay measured percentage decolorization using UV-Spectrophotometer with the following equation,
% Decolorization = (Initial OD-Final OD*100)/Initial OD