2.1 Patients
In brief, 242 patients including 148 males and 94 females, which underwent surgery and were diagnosed as primary HNSCC from 2009 to 2014 in the Affiliated Stomatological Hospital of Nanjing Medical University, were recruited. 242 HNSCC samples including 12 HNSCC adjacent normal tissues were used to make tissue microarrays[18]. The clinicopathologic information including age, gender, tumor size, lymph node status, histological grade, clinical stage and patients follow-up information were obtained from the patients’ electronic medical records and follow-up visits. Besides, we collected 48 pairs fresh HNSCC tissues and adjacent normal tissues to extract mRNA and choose 10 pairs of them to examine FAM83A protein level. All experimental were in accordance with the Institutional Review Board of the Nanjing Medical University and complied with the Declaration of Helsinki (Approval ID 2019343).
2.2 Immunohistochemistry and evaluation of immunoreactivity
The procedure of immunohistochemistry (IHC) was carried out as we described previously[19], The stained slides were analyzed by two pathologists separately. FAM83A staining strength was grouped by combining intensity score (IS) and positive score (PS). IS was divided into four groups: negative (0), weak (1), moderate (2), and strong (3), whereas PS was categorized into four grades: negative (0), <10% (1), 11%-50% (2), 51%-80% (3), and >80% (4). We then calculated the immunoreactive score (IRS) by multiplying IS and PS. The final IRS were divided into two groups: low FAM83A expression (≤4), and high FAM83A expression (>4). The antibodies used in IHC was FAM83A (1:100; Proteintech, Rosemont, IL, USA).
2.3 Cell lines and cell culture
The human normal oral keratinocytes (HOK) and the human HNSCC cell lines including CAL27, FADU, HN4, HN6 SCC-9, and SCC-25 cell, were purchased from China Center for Type Culture Collection (Shanghai, China), CAL27 and HOK is cultured in DMEM medium (Gibco). FADU, HN4, and HN6 were cultured in DMEM/F12 medium (Gibco).
All culture medium contained 10% fetal bovine serum (FBS, Sciencell) and 1% penicillin/streptomycin. Cells were cultured in a humidified incubator containing 5% CO2 at 37℃.
2.4 Lentiviral and siRNA transduction, and small-molecule inhibitor XAV-939
The human FAM83A lentivirus targeting to upregulate FAM83A (LV-FAM83A: 5'-GGAGTGTGGAAGGAGAGAT-3'), the negative control (LV-NC), the shRNA lentivirus targeting to knock down FAM83A (shFAM83A: 5'-GGAGUGUGGAAGGAGAGAUTT-3'), and the shRNA negative control lentivirus (shNC) were ordered from GeneChem Co., Ltd (Shanghai, China). Small interfere RNA (siRNA) of β-catenin (siβ-catenin: 5'-GGACACAGCAGCAAUUUGUTT-3) was used to silence β-catenin expression. XAV-939 (Selleck, USA), a small-molecule inhibitor, resolved with DMSO, was used to suppress β-catenin expression.
2.5 Real-time PCR and western blotting assays
Real-time RT-PCR and western blotting assays were carried out in accordance with standard process as we described previously[19]. Nuclear and cytoplasmic protein extraction from cells is in accordance with the TRIZOL reagent (Invitrogen) manufacturer’s protocol. The primers used as follows, FAM83A: forward 5’- ATCCGGAGTGTGGAAGGAGAG -3’, reverse 5’- TCCAGACAGGACAAATCTCCAGT -3’; E-cadherin: forward 5’-GCCTTATGATTCTCTGCTCGTG -3’, reverse 5’-GCCCCATTCGTTCAAGTAGTC-3’; N-cadherin: forward 5’-GTGAGCCTGCAGATTTTAAGGTG-3’, reverse 5’-GTTGGCTTCAGGCTCATTTTACT-3’; Vimentin: forward 5’-CTGGATTCACTCCCTCTGGTT-3’, reverse 5’-TCGTGATGCTGAGAAGTTTCGTT-3’; Snail: forward 5’- TTCTCACTGCCATGGAATTCC-3’, reverse 5’- GCAGAGGACACAGAACCAGAAA-3’; β-catenin: forward 5’- TGACAAAACTGCTAAATGACGAGG-3’, reverse 5’- CGCATGATAGCGTGTCTGGA-3’; C-myc: forward 5’- CCACGAAACTTTGCCCATAG -3’, reverse 5’- TGCAAGGAGAGCCTTTCAGAG-3’;Cyclin D1: forward 5’- TGTCCCACTCCTACGATACGC -3’, reverse 5’- CAGCATCTCATAAACAGGTCACTAC-3’; GAPDH: forward 5’-GACGTAGGGAGTGAAGGT C-3’, reverse 5’-GAGAGTTCAGATGTTGATGG-3’. Primary antibodies were as follows: GAPDH (1:1000; Proteintech, Rosemont, IL, USA), Lamin B1 (1:1000; CST), FAM83A (1:1000; Proteintech, Rosemont, IL, USA), E-cadherin (1:1000; CST),N-cadherin(1:1000; CST), Vimentin (1:1000; CST), Snail (1:1000; Proteintech, Rosemont, IL, USA), β-catenin (1:1000; CST), C-myc (1:1000; CST), and Cyclin D1 (1:1000; CST).
2.7 Cell migration and invasion assays
For the migration assay, 8×104 HNSCC cells in 200ul complete medium were seeded into the upper compartment of a transwell insert with 8mm pores (Costar, Lowell, MA, USA). The lower chamber was filled with 700ul basal medium containing 10% fetal bovine serum (FBS). After 12h (HN6 cell line) or 24 h (CAL27, FADU and HN4 cell lines), the invaded cells adhered to the lower compartment were fixed, stained, and counted under an inverted microscope (Olympus, Tokyo, Japan). For the invasion assay, 2×105 cells/well were plated and the upper compartment was pre-coated with Matrigel (Corning, Bedford, MA, USA).
2.8 Cell viability measurement
Cell viability was detected by CCK-8 assay (Dojindo Molecular Technologies, Kumamoto, Japan). Cells were seeded and cultured in 96-well plates at a density of 2000 cells/well. Every other day, CCK-8 reagent was added and the absorbance was determined at 450 nm.
2.9 Wound-healing assay
Cells were seeded into six-well plates and scratched with a 10ul pipette tip when cells grew to 90% confluence, and then cells were incubated with complete medium. At 0, 12, or 24 hours, wound closure was photographed and its percentage was calculated.
2.10 Immunofluorescence staining
Cells were plated onto coverslips and fixed in 4% paraformaldehyde for 20 mins when cells grew to 50% confluency. Then, the coverslips were permeabilized with or without 0.3% Triton, incubated with goat serum for 30 minutes and primary antibody overnight at 4 ℃. After the slides were incubated with DAPI (Life Technologies, USA), cells were observed and photographed under an FV1000 laser confocal scanning microscope (Tokyo, Japan). Primary antibodies used were as follows: E-cadherin (1:100, CST), Vimentin (1:100, CST), and β-catenin (1:100; CST).
2.11 In vivo assay
All animal experiments were in accordance with the Animal Use and Care Committee of the Affiliated Hospital of Stomatology, Nanjing Medical University (IACUC-1906018). Female 4-6 weeks old BALB/c nude mice used were purchased from Vital River Laboratory Animal Technology Co.Ltd (Beijing, China). To explore the role of FAM83A on HNSCC tumor growth, a total of 2×106 FAM83A knockdown cells and control cells were injected into the right armpit of mice. Tumor growth and body weight were determined every three days. After 25 days, mice were killed and tumors were stripped carefully. To explore the role of FAM83A on HNSCC tumor metastatic potential, a total of 1×105 cells were injected into the nude mice by tail intravenous. After 40 days, mice lungs were dissected carefully and the number of metastatic nodes were counted.
2.12 Statistical analysis
Data were presented as the mean ± s.d from three independent experiments and all data were analyzed via GraphPad Prism 7 (San Diego, CA, USA) software. P < 0.05 was considered significant in all experiments.