Plasmids and SiRNA.
The reporter constructs ERE-Luc, catD-Luc, and pS2-Luc and the expression vectors for ERα, Flag-tagged ERα, HA-tagged ERα, and all Mps1 expression constructs were generated. The cDNA target sequence of siRNA for Mps1 is GCACGUGACUACUUU CAAAUU. Flag-tagged ERα mutants were generated by quick-change mutagenesis kit (Strategene). Primers for mutations are:
S559A1: 5'-GGAGGGGCAGCTGCTGAGGAGACG-3'
S559A2: 5'-CGTCTCCTCCACAGCTGCCCCTCC-3'
T224A1: 5'-TATATGTGTCCAGCCGCCAACCAGTGCACCAT-3'
T224A2: 5'-ATGGTGCACTGGTTGGCGGCTGGACACATATA-3'
All plasmids were verified by restriction enzyme analysis and DNA sequencing.
Real-time RT-PCR
Real-time PCR was performed using PerfectStart® Green qPCR SuperMix (TransGen Biotech , AQ601-04) in triplicate and analyzed on an QuantStudio™ 3 Real-Time PCR System analyser (Thermo Fisher Scientific, A28136) as previously described. All real-time values were normalized to GAPDH. The primer sequences are:
for pS2:
5’- CTTCACTGATGCTGCTGTTCCT -3’ (forward)
5’- CCCACTGCCCCGAAGTTCCA -3’ (reverse);
for VEGFa:
5’- GCTACTGCCATCCAATCGAGACC -3’ (forward)
5’- CACACTCCAGGCCCTCGTCA -3’ (reverse);
for CyclinD1:
5’-CTGGCCATGAACTACCTGGA-3’ (forward)
5’-GTCACACTTGATCACTCTGG-3’ (reverse);
for CathepsinD:
5’- CACAACCTACTGGCCGACGAG -3’ (forward)
5’- GATTCCAGAAACGGCCCACA -3’ (reverse);
for GAPDH:
5’-CATGTTCGTCATGGGTGTGAACCA-3’ (forward)
5’-AGTGATGGCATGGACTGTGGTCAT-3’ (reverse);
Cell Culture and Transfection
All cells were cultured at 37℃ in 5% CO2 incubator, 293T cells were cultured in DMEM(EallBio, 03.1002C) medium, and ZR-751 cells were cultured in RPMI1640(EallBio,03.4007C) medium. MCF-7 breast cancer cells were cultured in DMEM(EallBio, 03.1002C) medium containing 0.01mg/ mL insulin, all medium containing 10% FBS, and the medium was changed every 2 days. In the hormone treatment experiment, 0.1% ethanol containing 1 μM tamoxifen was added into the culture medium of experimental cells, and 0.1% ethanol was added into the culture medium of control cells.
Luciferase reporter assays
293T and MCF-7 cells were cultured in DMEM containing 10% FBS at 37 ℃ in a humidified atmosphere of 5% CO2. For transfection, cells were seeded in 24-well plates containing phenol red-free DMEM medium supplemented with 2.5% charcoal dextran-treated FBS. The cells were transfected using Lipofectamine 2000 with 0.5 μg of ERE-LUC reporter plasmid, 50 ng of ERα expression vector and different amout of Mps1 or its mutants, and the respective empty vector was used to adjust the total amount of plasmid. Six hours later, the transfected cells were treated with 10 nM 17β-estradiol (E2) or 0.1% ethanol for 24 h, and then were harvested. Luciferase activities were determined according to the Firefly & Renilla Luciferase Reporter Assay Kit (Meilunbio,MA0518). All experiments were repeated at least three times with similar results
Cell Migration Assays
Cells were cultured in 6-well dishes and in DMEM medium containing 10% FBS. After cells adhesion, 95% confluence was achieved. A single layer of cells was wounded with the tip of a sterile pipette and a line was drawn on the diameter line of each hole to form a 1 mm cell-free path. Remove medium, with phosphate buffer (phosphatebuffersaline, PBS) gently cleaning the floating cells, after repeated 2-3 times, add 2 ml 10% FBS cultured MEM medium. The cells were fixed with 3.7% paraformaldehyde at the indicated times interval and photographed under a low power microscope to observe the healing of cell scratches
Western Blotting and Immunoprecipitation.
Cell extracts were prepared and immunoprecipitated were analyzed as previously described [29]. In brief, an aliquot of the total lysate [5% (vol/vol)] was included as a control for the interaction assay. Immunoprecipitation was performed with anti-Flag M2 Affinity Gel (A2220; Sigma–Aldrich), anti-Myc (A5598; Sigma–Aldrich), anti-ERα (catalogno. sc-7207; Santa Cruz Biotechnology), or anti-HA (H9658; Sigma–Aldrich) antibody. The antigen/antibody complexes were visualized by chemiluminescence.
In Vitro Kinase Assay.
293T cells were transfected with Flag-MPS1 or Flag-MPS1 (D2A) plasmid for 24 h. Cell lysates were prepared, and purified GST-ERα (2 μg) was mixed with the lysates in kinase buffer [20 mM Hepes (pH 7.5), 75 mM KCl, 10 mM MgCl2, and 10 Mm MnCl2] containing 2.5 mCi of [γ-32P]-ATP for 30 min at 37 °C. The reaction products were analyzed by SDS/PAGE and autoradiographed.
Statistics
Statistical analysis was performed using SPSS 17.0 (SPSS, Inc.) and R 2.13.0 (www.r-project.org). n = 3 independent experiments. All statistical tests were two-sided, and P values <0.05 were considered to be statistically significant.