Materials
The bentonite complex was provided by C&L Biotech Co. Ltd.. The ingredients of the bentonite complex are listed in Table 1. The bentonite complex for the in vivo assay was prepared at two concentrations (T1, 1 mg/mL; T2, 6 mg/mL) to evaluate dose dependency. Silver sulfadiazine 1% cream (Dongwha Pharm Co. Ltd, Seoul, South Korea) and saline solution were used for each positive control (PC) and negative control (NC).
Table 1
Components of bentonite complex
Name | Use | EWG green grade1 |
Bentonite clay | Anti-inflammation | 2 |
Purified water | Solvent | 1 |
Glycerine | Moisturizer | 2 |
Mineral oil | Skincare product | 2 |
Sparassis crispa extract | Moisturizer | 1 |
Cetearyl alcohol | Moisturizer | 1 |
Shea butter | Moisturizer | 1 |
Cetyl ethylhexanoate | Skin conditioning agent | 1 |
Theobroma cacao seed butter | Moisturizer | 1 |
Hydrogenated polyisobutene | Emollient | 1 |
Coconut oil | Skin conditioning agent | 1 |
Cyclopentasiloxane | Skin conditioning agent | 3 |
Beeswax | Skin care agent, detergent | 1 |
Setearyl alcohol | Moisturizer | 1 |
1,2-hexanediol | Antioxidant | 1 |
Olea europaea olive fruit oil | Water evaporation blocking agent | 1 |
Cetearyl glucoside | Emulsifier | 1 |
Dimethicone | Sebum controlling agent | 1 |
Glyceryle steate | Skin conditioning agent | 1 |
Cyclohexasiloxane | Skin conditioning agent | 2 |
Dimethicone | Skin protecting agent | 3 |
Dysodium edta | Antioxidant | 1 |
1EWG (Environmental Working Group) green grade: EWG green grade means scoring products within the range of 1 to 10 according to the standards set from the EWG’s study, with 1 representing the best score and 10 representing the worst. |
For the in vitro assay, bentonite clay (C&L Biotech Co. Ltd) was autoclaved at 121°C for 1 h. The specific elements of the bentonite clay in the mixture were precisely measured using inductively coupled plasma optical emission spectroscopy (ICP-OES, Agilent ICP-MS 7700S, Table 2). Sterilised bentonite clay was suspended in 1 mL of UV-irradiated phosphate buffered saline, diluted 10-fold (100, 10, and 1 µg/mL), and incubated for 1 h at room temperature. The solution was centrifuged at 13,000 × g for 2 h to elute the soluble fraction to avoid physical damage to the cell lines. The supernatant was carefully collected and passed through a 0.22 µm micropore filter to remove any insoluble debris.
Table 2
The elements of bentonite clay
Elements | Detection limit (mg/kg) |
Li | 44.6 ± 8.7 |
B | 5661.5 ± 483.5 |
Na | 32950 ± 10855 |
Mg | 8455 ±105 |
Al | 50400 ± 3200 |
Si | 209500 ± 19500 |
K | 19400 ± 400 |
Ca | 14450 ± 250 |
Ti | 2070 ± 30 |
V | 27.95 ± 0.45 |
Cr | 44.65 ± 1.55 |
Mn | 289 ± 5 |
Ni | 79.4 ± 11.2 |
Cu | 8.03 ± 0.85 |
Zn | 65.4 ± 9.2 |
Sr | 370.5 ± 15.5 |
Ba | 694 ± 26 |
Pb | 121 ± 16 |
The elements of the bentonite clay were measured by ICP-OES. Detection limit is represented as mean ± standard deviation (n = 2). |
Animals
Male and female Yucatan minipigs (Sus scrofa domesticus; Optipharm, Cheongju Korea), aged 7-8 months old and weighing 9.5-12.5 kg, were subjected to surgery to create burn wounds. They were bred in individual cages under specific pathogen-free (SPF) and controlled conditions (40-60 % humidity; 12 h/12 h light/dark cycle). Water was provided ad libitum, and food (Purina, St. Louis, USA) was provided daily at 2 % of the body weight. Clinical status was monitored every morning, and checkpoints were increased to twice a day after surgery. A designated photographer recorded macroscopic observations by taking pictures of each woundon days 2, 10, and 21 (necropsy).
For burn induction, the minipigs were anaesthetized by intramuscular injection of a mixture of ketamine (20 mg/kg) and xylazine (2 mg/kg). Anaesthesia was maintained with 0.5 ~ 5 % isoflurane. The burn wound was induced with a soldering iron with a square-shaped tip at 180°C, held against the skin for 5 s. Each wound was 3 × 3 cm2, spaced at a 5 cm interval, and had a depth of approximately 3 mm. The dorsal region of the minipigs was shaved with an electric clipper and cleaned with an alcohol swab to avoid infection. Full-thickness burns were induced on the dorsal region of minipigs, producing a total of eight wounds induced on each side of the spine line for NC, PC, T1, and T2. Post-surgical pain was managed with a peroral injection of acetaminophen (20 mg/kg). This study was approved by the Institutional Animal Care and Use Committee (approval number: KIT 1910-0348).
In vitro assay
The porcine lung macrophage cell line 3D4/2 (ATCC CRL-2845) and the human keratinocyte cell line HacaT (ATCC PCS-200-011) were used for the in vitro assays. The cells were grown at 37°C and 5% CO2 in culture media containing 10% foetal bovine serum (Gibco, Waltham, MA, USA) and 1% penicillin-streptomycin (10,000 unit/mL; Gibco). A total of 20 ng of lipopolysaccharide (LPS, Sigma-Aldrich, St. Louis, MO, USA) were added over a period of 6 h to induce immune cell stimulation. The bentonite clay was then mixed with the culture media (1:1) and treated with HacaT and 3D4/2.
Quantitative real-time PCR
Total RNA was isolated manually using the phenol-chloroform method. Reverse transcription reactions were performed using the QuantiNova Reverse Transcription Kit (Qiagen, Hilden, Germany). Quantitative real-time PCR (qRT-PCR) was performed in a 25 µL reaction mixture that included 2× Power SYBR Green PCR Master Mix (Applied Biosystems, Waltham, MA, USA), each primer at a concentration of 0.5 µM, and QuantStudio 5 Real-Time PCR System (Applied Biosystems). The following amplification parameters were used in the qRT-PCR: an initial denaturation step at 95°C for 10 min followed by 40 cycles of denaturation at 95°C for 15 s, annealing and elongation at 60°C for 1 min, without the final elongation step. Primer sequences used for qRT-PCR are listed in Table 3. GAPDH was used as an endogenous control. The 2 − ΔΔCt method was used for relative quantification of target genes.
Table 3
Primers used for quantitative real-time PCR
Species | Gene symbol | Primer sequences (from 5’ to 3’) | Length (bp) | Gene Bank ID |
Porcine | COX-2 | F: TTCAACCAGCAATTCCAATACCA | 87 | NM_214321.1 |
R: GAAGGCGTCAGGCAGAAG |
PTGES | F: AGAGCATGAAAACCATCACTCC | 248 | NM_001038631.1 |
R:CTCAAGGACATTCTGTCAGGTTC |
CCL2 | F: CTCCCACACCGAAGCTTGAA | 120 | NM_214214.1 |
R: TAATTGCATCTGGCTGGGCA |
CXCL2 | F: ATCCAGGACCTGAAGGTGA | 116 | NM_001001861.2 |
R: TTCTTCACCATGGGGGCT |
TGFβ | F: AGGGCTACCATGCCAATTTCT | 101 | NM_214015.2 |
R: CGGGTTGTGCTGGTTGTACA |
TNFα | F: ATGAGCACTGAGAGCATGATCCG | 163 | NM_214022.1 |
R: CCTCGAAGTGCAGTAGGCAGA |
IL-1β | F: GAGCATCAGGCAGATGGTGT | 134 | NM_214055.1 |
R: CAAGGATGATGGGCTCTTCTTC |
IL-6 | F: GCTGCTTCTGGTGATGGCTACTGCC | 318 | NM_001252429.1 |
R: TGAAACTCCACAAGACCGGTGGTGA |
GAPDH | F: ACAGACAGCCGTGTGTTCC | 62 | NM_001206359.1 |
R: ACCTTCACCATCGTGTCTCA |
Human | COX-2 | F: GAATGGGGTGATGAGCATGT | 99 | NM_000963.4 |
R: GCCACTCAAGTGTTGCACAT |
IL-1β | F: GTGGCAATGAGGATGACTTGTTC | 103 | NM_000576.3 |
R: TAGTGGTGGTCGGAGATTCGTA |
PTGES | F: CTGCTGGTCATCAAGATGTACG | 223 | NM_004878 |
R: GGTTAGGACCCAGAAAGGAGT |
TGFβ | F: CCCTGGACACCAACTATTGC | 131 | NM 000660.7 |
R: GCAGAAGTTGGCATGGTAGC |
GAPDH | F: CCACTCCTCCACCTTTGAC | 102 | NM 002046.7 |
R: ACCCTGTTGCTGTAGCCA |
Enzyme-linked immunosorbent assay (ELISA)
The production of prostaglandin e2 (PGE2) in cell lines and skin tissues was determined by a Prostaglandin E2 Parameter Assay Kit (R&D Systems, Minneapolis, MN, USA). The assay was performed according to the manufacturer’s instructions.
Immunohistochemistry
Tissues were fixed in neutral buffered formalin overnight and embedded in paraffin. Tissue samples were sectioned (5 µm), deparaffinized, processed for antigen retrieval, blocked, and incubated with the primary antibody (dilution 1:100) targeting the Ki-67 antigen (cat#9949, Cell Signalling Technology, MA, USA), VEGF (cat#ab1316, Abcam, CA, UK) and peroxidase-conjugated secondary antibody. The samples were mounted and photographed using a microscope (LSM800 or AxioVision; Zeiss, Oberkochen, Germany). For comparison among the experimental groups, images were captured at the same exposure time. For the peroxidase-conjugated secondary antibody, 3,3- diaminobenzidine substrate was used, followed by hematoxylin for nuclear counterstaining. Expressions of VEGF and Ki67+ cells were measured using the open-source image analysis tool, Image J software (version 1.53 https://imagej.nih.gov/ij/index.html, National Institutes of Health, MD, USA).
Masson’s trichrome staining
The experiments were performed according to the manufacturer’s protocol (cat#IFU-2, ScyTek, Logan, UT, USA). Deparaffinized slides were incubated with Weigert’s iron hematoxylin, Biebrichscarlet-acid fuchsin solution, phosphomolybdic-phosphotungstic acid solution, and aniline blue solution. The slides were then rinsed with 1% acetic acid solution. Collagen connective tissue showed a bluish colour. Dermal regeneration was calculated using the following formula: 100 × collagen deposition (blue colour) length/total dermis layer length.
Statics
The comparison analysis was performed using Prism 7 (GraphPad Software, San Diego, CA, USA). All graphs are presented as the mean ± standard deviation. All experiments were performed in triplicate. Statistical analyses were performed using one-way analysis of variance and two-tailed Student’s t-test. Differences were considered statistically significant at p < 0.05.