Patients and sample collection
For this study, the tissue microarrays (TMAs) slides included examination of 498 pairs of tissue specimens including CRC tissues and the matched corresponding adjacent normal colorectal tissues from CRC patient cohorts that were enrolled at Affiliated Hospital of Xuzhou Medical University from 2010 to 2015 in China. Clinical and pathological information was obtained from the medical records of the Affiliated Hospital of Xuzhou Medical University. Survival time was calculated based on the date of surgery to the date of death or to the last follow-up. The patient studies were conducted in accordance with Declaration of Helsinki. The use of these specimens and data for research purposes were granted approval by the Ethics Committee of the Affiliated Hospital of Xuzhou Medical University.
Cell Culture And Cell Treatment
The CRC cell lines and HEK293T cell were obtained from the cell bank of Chinese academy of sciences. SW480, SW620, HCT116, DLD1, LOVO, HT29, FHC and HEK293T cells were cultured in 1640 and DMEM Medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 100 µg/ml streptomycin, and incubated in a 37 °C humidified incubator with 5% CO2. 1% O2 was generated by flushing a 94% N2/5% CO2 mixture into the incubator.
The small interfering RNAs (siRNA, 50 nM) against human IGF2BP2 and DHX9 were transfected into the CRC cells SilenFect reagent (Thermo Fisher Scientific Inc, USA), while non-specific siRNA was used as negative controls. All siRNAs were purchased from Genepharma Technology (Shanghai, China). The sequences of the siRNAs were listed in below:
siIGF2BP2 :
CAGUUUGAGAACUACUCCUTTAGGAGUAGUUCUCAAACUGTT
siDHX9 :
GCCUCCAAGAAAGUCCAAUTTAUUGGACUUUCUUGGAGGCTT
Establishment Of Stable Cell Lines
The cDNA of LINC00460 was inserted into pCDH-CMV-MCS-EF1-GreenPuro lentivirus vector at ECOR1/BamH1 sites. LINC00460 shRNA sequences were cloned to the vector pLko.1 at Age1/ECOR1 sites. The METTL3 shRNA vectors were purchased from GENE company (Shanghai, China). The overexpression and knockdown lentiviruses were generated by co-transfecting 293T cells with the other two packing vectors pMD2G and psPAX. The supernatants of 293T cultured medium were collected 48 h later, filtered through 0.45-mm filters (Millipore, Temecula, CA, USA) and concentrated using Amico Ultra centrifugal filters (Millipore 100KD MWCO). The concentrated virus was used to infect HCT116 and SW480 cells and stable LINC00460 overexpression or knockdown cells were generated by lentivirus infection. The relative LNC00460 and METTL3 shRNA sequences were described as below:
ShLINC00460#1-For: CCGGGGTACCCAGACATTGTTATGACTCGAGTCATAACAATGTCTGGGTACCTTTTTG;
ShLINC00460#2-For: CCGGGGAGGCGTCTGTGTAGCAATTCTCGAGAATTGCTACACAGACGCCTCCTTTTTG;
shMETTL3#1-For: CCGGGCAAGTATGTTCACTATGAAACTCGAGTTTCATAGTGAACATACTTGCTTTTTG
shMETTL3#2-For: CCGGGCCAAGGAACAATCCATTGTTCTCGAGAACAATGGATTGTTCCTTGGCTTTTTG
RNA extract, Reverse transcription-PCR and qRT-PCR
RNA was extracted using TRIzol (Invitrogen) and cDNA was synthesized using the HiScript 1st Strand cDNA Synthesis Kit (Vazyme Biotech, Nanjing, China). Real-time PCR was carried out on ABI-7500 using UltraSYBR One Step RT-qPCR Kit (CWBIO, Beijing, China). The primers using for quantitative RT-PCR analysis were listed in Additional file 1: Table S1:
Western Blot And Antibodies
Western blot and Antibodies
Cells were harvested, total protein from cells was extracted by using RIPA lysis buffer and was qualified by using a BCA detecting kit (Keygen, Nanjing, China). Proteins samples were subjected to 7.5% or 10% SDS-PAGE and transferred onto a PVDF membrane, and then incubated with specific antibody at 4℃ overnight, respectively. The next day, the membranes were incubated with secondary antibodies included HRP-goat anti-mouse, HRP-goat anti-rabbit (ABclonal) at room temperature for 1 hour. Protein bands were detected on Tanon 5200 automatic chemiluminescence imaging analysis system using ECL reagent (Tanon, Shanghai, China). Antibody against GAPDH was used as control (sc-32233, Santa Cruz, Dallas, TX, USA). HMGA1 (A1635, ABclonal, Wuhan, China), IGF2BP2 (11601-1-AP, Proteintech, USA), DHX9 (17721-1-AP, Proteintech, USA), E-cadherin (610181,BD Biosciences, Bedford, Massachusetts, USA), N-cadherin (610920,BD Biosciences, Bedford, Massachusetts, USA),β-catenin (610154, BD Biosciences, Bedford, Massachusetts, USA), were used for Western blot assays.
In situ hybridization (ISH) and immunohistochemistry (IHC)
The in situ hybridization of LINC00460 was performed on formalinfixed paraffin-embedded sections using specific oligonucleotide probe (Hs-LINC00460, RNAscope ® 2.5, ACD, US), following the manufacturer instructions. Positive control probe (Hs-PPIB) and Negative control probe (DapB) were included for each hybridization procedure and analyzed using a OLYMPUS microscope with OLYMPUS OlyVIA V2.9 software.
IHC assays was implemented following a standard streptavidin-peroxidase (SP) method as previously reported [23] and heat induced epitope retrieval (HIER) was performed with the retrieval buffer, citrate, pH 6.0, prior to commencing with IHC staining protocol. For primary antibody incubation, anti-HMGA1 (A1635, ABclonal, Wuhan, China) antibody at 1:100 dilution. The slide without primary antibody incubation served as negative control.
RNA fluorescence in situ hybridization (FISH)
Cells were seeded on glass bottom cell culture dish (801001, NEST) for about 24 hr, then cells were fixed with 10% neutral buffer formalin, incubation with hydrogen peroxide (2005617, RNAscope®) and protease Ⅲ (2004920, RNAscope®) for about 10 min separately. After cell preparation and pretreatment, following the manufacturer instructions and used specific oligonucleotide probe (RNAscope ® 2.5, ACD, US) to visualize the single RNA in each cell. The nuclei were stained with DAPI for 15 min. Finally, images were taken under a confocal microscope.
Cellular Proliferation, Colony Formation Assays
CCK-8 assay was applied to measure the cell proliferation according to the Cell Counting Kit-8 manufacturer protocol (Dojindo, Japan). Colony formation assay was performed in 60 mm dishes one thousand cells seeded and two weeks cultured. Colonies were counted manually after staining with 0.1% crystal violet.
Real Time Cellular Analysis (RTCA)
The Real Time Cell Analyzer (xCelligence, RTCA, USA) were used for examined the effect of LINC00460 on cell proliferation. The xCELLigence system was used according to the instructions of the supplier (ACEA Biosciences). The system measured impedance differences to derive cell index values at time points and it may be set by the operator.
The xCELLigence system consists of four main components: the RTCA analyzer, the RTCA DP station, the RTCA computer with integrated software and disposable E-plate 16. Firstly, the optimal seeding concentration for proliferation assay was determined. After seeding the number of 5000 cells in 200 ml medium to each well in E-plate 16, the attachment and proliferation of the cells were monitored every 15 min. All experiments were carried out for 96 hr .
Cell migration, invasion and wound healing assays
Cells were starved in serum-free media for 24 hr then added to the top chamber of 24-well transwell chambers plates (8.0 µm, Corning, NY, USA.). Specially, for the invasion assay, cells were seeded into the top chamber coated with Matrigel (BD Biosciences). Complete medium was added to the bottom chambers to stimulate migration or invasion. After incubation for 24–48 hr, the cells those adhered to the lower surface of the membrane were stained with 0.1% Crystal Violet, and then the percentages of migrated or invasion cells were calculated. Five randomly selected fields per filter were counted.
In wound healing assay, cells were seeded at a density of 1 × 106 cell/well onto six-well plates and cultured to about 80% confluence. Then, a sterile 10-µl pipette tip was used to form artificial scratches for each well. The suspended cells were washed away with PBS, and then the cells were cultured in medium with 1% FBS. Cell migration distance was photographed at 0 h and 24 h under an inverted light microscope.
RNA pull-down assay and Mass spectrometry
RNA pull-down assay was carried out as described briefly: in vitro biotin-labeled RNAs (LINV00460, its antisense RNA) were transcribed with Biotin RNA Labeling Mix (Promega Corporation, US) and T7 RNA polymerase (Thermo Fisher Scientific, US) treated with RNase inhibitor, and purified with Clean-up kit (Promega Corporation, US). The biotinylated LINC00460 probes were dissolved in binding and washing buffer and incubated with Streptavidin Agarose Resin (Thermo Fisher Scientific, US). Then cell lysates of HCT116 and SW480 were incubated with probes-coated streptavidin beads, and pull-down proteins were run on SDS-PAGE gels, and then gels were stained by Coomassie Blue staining, and differential bands were cut off for Mass spectrometry (Shanghai Applied Protein Technology Co., Ltd. China).
RNA immunoprecipitation
The RIP experiment was carried out with the EZ-Magna RIP Kit (Millipore) according to the manufacturer’s protocol using 5 mg of antibody. HCT116 and SW480 cells were lysed in complete RIP lysis buffer, and the cell extract was incubated with protein A/g agarose beads conjugated with specific antibodies or control IgG for 2 hr at 4℃. Beads were washed and incubated with Proteinase K to remove proteins. Finally, purified RNA was subjected to quantitative RT-PCR analysis. Antibody IGF2BP2 (11601-1-AP, Proteintech, China), DHX9 (17721-1-AP, Proteintech, China).
MeRIP
MeRIP, we used Anti-N6-methyladenosine (m6A) antibody (ab151230) to pull down m6A modified HMGA1. Total RNA was extracted from cells using Trizol (Thermo-Fisher). 100 µg RNA was added to 500 µl MeRIP buffer (150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 0.1% NP-40) and incubated briefly with 1 µl rabbit IgG and then the IgG was removed by protein A/G beads. The pre-cleaned lysates were transferred to new tubes and incubated with rabbit IgG or m6A antibody for 2 hours at 4 °C with rotation. Finally, m6A bound RNA was extracted with Trizol and the RNA level of HMGA1 was measured by qRT-PCR.
Animal work
The female BALB/c nude mice (6–8 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All animal experiments were approved by the Animal Care and Use Committee at Xuzhou Medical University. Groups of HCT116-Luc-shCtrl, HCT116-Luc-shLINC00460, and HCT116-Luc-shLINC00460 + HMGA1 cells (5 × 106) were injected subcutaneously into the flanks of mice correspondingly. Tumors volume (V) was monitored every 2 days by measuring the long axis (L) and the short axis (W) of xenograft tumor and calculated with the following formula: V = (L × W2)/2.
Bioinformatics of gene expression database
The correlation of LINC00460 expression and CRC patient survival were analyzed using the datasets generated with Affymetrix HGU133 Plus 2.0 microarrays. Data are deposited at the Gene Expression Omnibus (GSE40967). GSE40967 contains 566 CRC tissues.
Statistical analysis
Statistical analyses were carried out using SPSS 20.0 software (SPSS Inc., Chicago, IL, USA) and GraphPad Prism 8 The association between LINC00460 and the clinicopathologic parameters of the CRC patients were evaluated by a Chi-square test. The Kaplan–Meier method and log-rank test were used to evaluate the correlation between LINC0046 expression and CRC patient survival. The unpaired t test was used to determine the statistical significance of differences between groups. Data were presented as mean ± SD. p < 0.05 was considered statistically significant.