Patients
Four cases with heterogenous MMR protein staining were retrieved from 500 cases of CRC resections in the pathology files in the Department of Pathology, Fudan University Shanghai Cancer Center during 2018 - 2020. All the cases were reviewed by two senior pathologists. Clinicopathologic information of these 4 cases was obtained from the medical records and/or discharge summary (Table1). Formalin-fixed paraffin- embedded sections, including the primary tumor tissues, metastatic lymph nodes, and matching normal tissue sections (3-4 µm thick) were collected. The present study was approved by our institutional ethics committee. All tests of samples in this study were carried out in ISO15189 certified laboratories.
Table 1
Clinicopathological characteristics of 4 CRCs with heterogenous MMR protein expression
Case No. | Sex /Age | Location | Size (cm) | Histologic Type | Differentiation | LN status | pTNM | Stage |
1 | F/53 | Right colon | 1.8 | Adca | Moderate-Poor | 0/31 | T1N0M0 | Ⅰ |
2 | F/67 | Right colon | 2.0 | Adca | Moderate-Poor | 2/29 | T3N1bM0 | ⅢB |
3 | M/50 | Sigmoid colon | 3.0 | Adca | Moderate | 3/22 | T3N1bM0 | ⅢB |
4 | M/68 | Right colon | 7.5 | Adca, partly MA | Moderate-Poor | 0/34 | T3N0M0 | ⅡA |
CRC: colorectal cancer; MMR: mismatch repair; Adca: adenocarcinoma; MA: mucinous adenocarcinoma; LN: lymph node. |
Hematoxylin and eosin (H&E)-stained sections of the resection specimens were reviewed. Several parameters, including tumor size, lesion location, the depth of tumor invasion, histological morphology, and grading were recorded. CRC staging was performed according to the 8th American Joint Committee on Cancer (AJCC) cancer staging manual based on Tumor-Node-Metastasis (TNM) classification scheme.
Immunohistochemistry
Immunohistochemistry( IHC) for MMR proteins (MLH1, PMS2, MSH2, and MSH6), and other biomarkers including chromogranin A (CgA), synaptophysin (Syn), Caudal related homeodomain transcription 2 (CDX2), and Special AT-rich sequence-binding protein 2 (SATB2) was performed on 4 µm thick paraffin tissue sections using the following monoclonal antibodies: MLH1 (Roche, USA), PMS2 (Roche Diagnostics, USA), MSH-2 (Roche, USA), MSH6 (Roche, USA), CgA (MXB, China), Syn(DAKO, Denmark), CDX2(Roche, USA), and SATB2(ZSGB, China). Staining was performed on autostainer Benchmark XT/Ultra (Ventana Medical Systems, Tucson, AZ, USA) using OptiView universal DAB IHC detection and Amplification kit (Ventana), according to the manufacturer’s instructions. The nuclear expression of all the 4 MMR markers (MLH1, PMS2, MSH2, and MSH6) was considered to be pMMR. The complete loss of nuclear expression of any of the 4 MMR markers in the neoplastic cells was considered as dMMR. The heterogeneity of MMR protein staining was defined as zonal or focal loss of MMR expression coexisting with other areas with diffuse expression[13, 16–18]. Appropriate positive and negative controls were included.
Microdissection And Dna Extraction
Intra-tumoral components with heterogenous MMR protein expression were separately microdissected by laser capture microdissection (LCM, Arcturus XT; Life Technologies, Mountain View, CA, USA) as previously described[19, 20]. Briefly, ten 6-µm-thick histologic sections were prepared from each selected block and adhered to a 1.4-µm membrane with metal frame slides (Applied Biosystems, Foster City, Germany). After drying and dewaxing routinely, these sections were fixed in 100% ice-cold ethanol for 10min, stained with hematoxylin for 1 min, and dehydrated in 100% ethanol for 30s and xylene for 5min. Target components with heterogenous MMR expression were isolated separately using an LCM system. Genomic DNA from different intra-tumoral components and corresponding metastatic lymph nodes with heterogenous MMR protein expression, as well as matching normal mucosa samples were extracted with the QIAamp DNA Mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions.
Pcr-based Msi Testing
Microsatellite instability status was evaluated by a fluorescent PCR-based assay with Promega MSI Analysis System (Promega Corporating, Madison, US), which included five mononucleotide markers (BAT-25, BAT-26, NR-21, NR-24, and MONO-27) and two pentanucleotide markers (Penta C, Penta D). The testing was conducted as previously described[21]. Briefly, Promega MSI testing was performed with a 2 ng DNA input for separately microdissected intra-tumoral components and metastatic lymph nodes with heterogenous MMR protein expression. PCR amplification was carried out in a GeneAmp PCR 9700 thermocycler (Applied Biosystems) and capillary electrophoresis was carried out in an ABI 3500xL automated DNA sequencer (Applied Biosystems). Data were analyzed with the GeneMapper Software Analyzer (Thermo Fisher Scientific, Waltham, MA). Compared with the normal mucosa control tissues, tumors were defined as MSI-high (MSI-H) when ≥ 2/5 of the mononucleotide markers were altered, MSI-low (MSI-L) with only 1 marker altered, and microsatellite stable (MSS) with stability for all the five markers.
Methylation-specific Pcr Analysis
Extracted DNA from different intra-tumoral components and corresponding metastatic lymph nodes with heterogenous MMR protein expression was treated with bisulfite to convert unmethylated cytosines to uracil while leaving methylated cytosines unaltered. MLH1 promoter methylation status was analyzed by means of a fluorescence-based, real-time methylation-specific PCR assay using the Human MLH1 Gene Methylation Detection Kit (Gene Tech (Shanghai) Company Limited, China) according to the manufacturer’s instructions. This kit analyzed the methylation of 5 CpG sites (AGAGCGGACAGCGATCTCTAACGCGCAAGCGCAT, chr3: 37, 034, 766-37,034,799, GRCh37/hg19). The PCR reactions (95℃ for 3 min, followed by 45 cycles of 95℃ for 15 sec and 60℃ for 60 sec) were performed on an ABI 7500 analyzer (Applied Biosystems, Foster City, CA). The Ct value of the sample and the external control must be less than or equal to 32. Positive results were defined as Ct (sample) - Ct(control) ≤7. Samples were run in duplicate, including positive and negative controls.
Dna-based Next Generation Sequencing
The ColonCore panel (Burning Rock Biotech, Guangzhou, China) is designed for simultaneous detection of MSI status and mutations in 41 CRC-related genes, including KRAS, NRAS, BRAF, PIK3CA, hereditary CRC genes, MMR genes, and other genes related to carcinogenesis and tumor development. The genes included in this panel are listed in Supplementary Table 1. All the detection was carried out according to the manufacturer's instructions as previously described using a NextSeq platform (Illumina Inc., San Diego, CA)[22, 23]. Briefly, DNA shearing was performed using Covaris M220 (Covaris, Inc., MA, US), followed by end repair, phosphorylation, and adaptor ligation. Fragment sizes ranging from 200 to 400 bp were selected using Agencourt AMPure beads (Beckman Coulter, CA, US) followed by hybridization with capture probes baits, hybrid selection with magnetic beads, and PCR amplification. Subsequently, Qubit® 3.0 and Agilent 2100 bioanalyzer (Agilent Technologies Inc., CA, US) was performed to assess the quality and size of the fragments. Indexed samples were sequenced on the Nextseq500 sequencer (Illumina, Inc., CA, US) with pair-end reads. The sequencing data were mapped to the human genome (hg19) using Burrows-Wheeler Aligner version 0.7.10. Local alignment optimization, variant calling, and annotation were performed using the Genome Analysis Toolkit version 3.2 and VarScan version 2.4.3.
The method of MSI phenotype detection in this ColonCore panel was a read-count-distribution-based approach. It took the coverage rate of a set of specific repeat lengths as the main feature of each microsatellite locus. The determination of MSI status was not required for the matched normal tissues. If the coverage rate was less than a given threshold, the locus was classified as unstable. The MSI status of a sample was determined by the percentage of unstable loci in the given sample. A tumor sample was considered MSI-H if more than 40% of the marker loci were length-instable, MSS if the percentage of length-instable loci was less than 15%, or MSI-L if the percentage was between 15–40%[22].