Animals and Diabetes Induction
The animal experimental protocol was approved by the Bioethics Committee of Renmin Hospital of Wuhan University. Healthy male adult Sprague-Dawley (SD) rats were supplied by Beijing Vital River Bioscience Co. Ltd, weighing 200-220g, 6-8weeks old. After 5 days of acclimatization, the rats were fasted for 12 h for diabetes induction. The diabetic rats were administered a single intraperitoneal injection of 60 mg/kg streptozotocin (STZ) dissolved in citrate buffer to induce diabetes as described previously[18]. The non-diabetic rats were injected with an equal volume of sodium citrate buffer. After 72h (with 6h fasting), the rats exhibiting hyperglycemia (blood glucose level higher than 16.7 mmol/l), polyphagia, polydipsia and polyuria were considered to have diabetes.
Reagents
Streptozotocin (STZ), triphenyl tetrazolium chloride (TTC) and Evans blue (EB) were purchased from Sigma Chemical Co. (MO, USA). Dulbecco’s modified Eagle’s medium (DMEM) and fetal bovine serum (FBS) were obtained from Gibco Laboratories (Grand Island, NY, USA). Sulforaphane (SFN), the NRF2 agonist was purchased from Glpbio Co. (CA, USA). Erastin (Era), the ferroptosis agonist was purchased from Selleck (Houston, TX).The cell counting kit-8 (CCK-8) and 2',7'-dichlorofluorescein diacetate (DCFH-DA) assay test kits were obtained from Beyotime Institute of Biotechnology (Shanghai, China). Lactate dehydrogenase (LDH), enzyme-linked immunosorbent assay (ELISA),superoxide dismutase (SOD), malondialdehyde (MDA) and Fe2+ assay test kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, Jiangsu, China). The primers for NRF2, FPN1, ACSL4 and β-actin were designed and synthesized by Wuhan servicebio Co. (Wuhan, Hubei, China). NRF2 primary antibodies were purchased from Cell Signaling Technology (CST, Beverly, CA, USA). FPN1, ACSL4, GPX4 and GAPDH primary antibodies were obtained from Proteintech Co. (Wuhan, Hubei, China).
Glucose tolerance Testing
The diabetic rats fasted overnight, and then glucose was administered at a dose of 2g/kg by gastric lavage or intraperitoneally injection to conduct the oral glucose tolerance test (OGTT) and intraperitoneal glucose tolerance test (IPGTT) to confirm the success of animal model. Blood glucose level was measured at 0 (before glucose load), 30, 60, 90, and 120 min. All blood samples were collected from the tail to determine plasma glucose.
Myocardial Ischemia and Reperfusion Model
Rats were anesthetized by intraperitoneal injection of 1% sodium pentobarbital (60mg/kg) and managed for electrocardiogram (ECG) monitoring. After disinfection of skin, tracheotomy was performed and the ventilator was connected for mechanical ventilation. The ribs were cut at the 3rd to 4th intercostal space in the left midclavicular line and the entire heart is fully exposed. Subsequently, the left anterior descending coronary artery (LAD) below the left auricle was ligated with a 7-0 silk wire. Successful ischemia is indicated when there is a change in color from red to white in the apical region and left ventricular wall with reduced ventricular wall motion and an elevated ST-segment arch in the ECG. After 30 min, the apical and left ventricular color gradually returned to red and the ST-segment recovered, suggesting successful reperfusion, as seen by loosening the ligature.Lastly, the myocardium was reperfused for 2h (for protein expression and serological indicators measurement) or 72h (for cardiac function measurement). Furthermore, the ligation thread was passed through the LAD but not ligated in the sham operation group.
Experimental Protocols
For the in vivo study, 8 weeks after STZ injection, all rats were randomly divided into 4 groups: (1) normal + sham group (NS); (2) normal + ischemia-reperfusion group (NIR); (3) diabetes + sham group (DS); (4) diabetes + ischemia-reperfusion group (DIR).To gain a deeper insight into the effect of NRF2 activation, the following expriments were preformed among diabetic rats: (1) diabetes + ischemia-reperfusion group (DIR); (2) diabetes + ischemia-reperfusion + sulforaphane group (DIR + SFN); (3) diabetes + ischemia-reperfusion + SFN+Erastin group (DIR + SFN + Era). Each group contains 8 rats. The NRF2 agonist sulforaphane (500mg/kg/day) was injected intraperitoneally for 3 days before ischemia[19]. And the ferroptosis agonist Erastin (20mg/kg) was injected intraperitoneally at the beginning of the ischemia-reperfusion operation.
For the in vitro study, H9c2 cardiomyocytes were randomly assigned to 6 groups: (1) low glucose group (5.5 mM); (2) low glucose + hypoxia-reoxygenation group (H/R) ; (3) high glucose group (HG) (30mM); (4) high glucose + hypoxia-reoxygenation group (HH/R); (5) high glucose + hypoxia-reoxygenation + sulforaphane group (HH/R + SFN); (6) high glucose + hypoxia-reoxygenation + sulforaphane + Erastin group (HH/R + SFN + Era). H9c2 cardiomyocytes of all groups were cultured in low-glucose DMEM containing 10% FBS and 1% penicillin/streptomycin and incubated in normoxic incubator at 37℃ in a humidified atmosphere of 5% CO2. When the density of H9c2 cardiomyocytes reached 70%-80%, all cells were digested with trypsin containing ethylenediaminetetraacetic acid (EDTA) and transferred to 6-well culture plates for subsequent experimental treatments. To simulate the high glycemic state,cells were cultured in serum-free medium overnight and exposed to HG medium for 24 h. For the H/R cell model, cells were subjected to hypoxic state (94% N2 + 5% CO2 + 1% O2) for 6h and followed by reoxygenation (95% air + 5% CO2) for 2h. Sulforaphane and Erastin was given 24h before H/R. The experimental protocol is depicted schematically in Fig. 1.
Determination of Myocardial Infarction
After 2h of ischemia-reperfusion treatment, six rats in each group were randomly selected to ligate LAD along with the original site. The 2% Evans Blue reagent was slowly injected from the femoral vein, while the non-ischemic area showed blue staining region.The aorta was immediately clamped and the heart was removed and sliced along the longitudinal axis. Five pieces of heart slices were prepared, placed in the 1% TTC solution in a 37℃ incubator for 30 min in the dark. The slices were then fixed in 4% paraformaldehyde for 30 min, scanned by the scanner (Epson, v30, Japan). And the myocardium area was calculated with an image analysis system (Image J; National Institutes of Health, USA). Theoretically, normal myocardium appears blue, ischemic myocardium shows brick-red, and infarcted myocardium displays pale. For ischemic myocardium stained by TTC staining, brick-red myocardium was defined as the area at risk (AAR) and pale myocardium was defined as the infarct area (IA). The percentage of myocardial infarction area was calculated as IA versus AAR (IA/AAR×100%).
Echocardiography
In order to avoid the interference of residual gas in the thoracic cavity on the echocardiography after thoracotomy, 6 rats were taken from each group after 72h of reperfusion. Rats were anesthetized with 2-3% inhaled isoflurane and fixed on the operating table.The MyLab 30CV ultrasound system (Biosound Esaote, Indianapolis, IN, USA) with a 15-MHz transducer probe was used to perform two-dimensional and M-mode echocardiographic measurements. Parasternal long axis and short axis images were obtained in short and long axes in two-dimensional and M-mode for quantification. Left ventricular internal dimension systole (LVIDs) and left ventricular internal dimension diastole (LVIDd) were measured on the parasternal LV long axis view. Left ventricular ejection fraction (LVEF) and left ventricular shortening fraction (LVFS) were calculated by computer algorithms. All measurements that represented the mean of 5 consecutive cardiac cycles, were performed in a blinded manner.
Hematoxylin and eosin staining
Myocardial tissue was fixed overnight in 4% paraformaldehyde at 4°C. The tissue was then dehydrated in a series of ethanol and xylene solutions and embedded in paraffin wax. Cut the heart tissue block into 4μm thick tissue sections with a microtome. According to the manufacturer's instructions, hematoxylin and eosin (HE) staining was performed to assess the morphological changes and damage degree.
Measurement of serum CK-MB and LDH levels
At the end of reperfusion, arterial blood samples were collected and centrifuged at 1200 rpm for 15 min. The creatine kinase-MB (CK-MB) was detected by an ELISA kit and lactate dehydrogenase (LDH) was detected by colorimetry with an LDH assay kit according to the manufacturer's instructions.
Cell Viability Assay
Cells were plated in 96-well plates at a density of 3000 cells/well, grouped according to the experiment (5 replicate wells per group). After cells were cultured and treated in 96-well plates, 10 μL of CCK-8 reagent was added to each well and then incubated for 2 hours in the dark. Absorbance was detected at 450 nm with a microplate reader (Perkin Elmer, USA).
Measurement of malondialdehyde (MDA) level, ferrous ion (Fe2+) level, superoxide dismutase (SOD) activity
After modeling, the cells and cell supernatant were collected to measure the malondialdehyde (MDA) level, antioxidant enzyme superoxide dismutase (SOD) activity and intracellular Fe2+ concentration by spectrophotometry according to the manufacturer’s instructions. Then, the intensity was observed by a microplate reader.
ROS measurement
Intracellular reactive oxygen levels were measured with the 2',7'-dichlorofluorescein diacetate (DCFH-DA) molecular probe. Briefly, cardiomyocytes in 6-well plates were loaded with the appropriate amount of DCFH-DA probe for 30 min at 37°C in the dark. DCFH-DA was oxidized and converted to highly fluorescent DCFH and showed green fluorescence in the cytoplasmic lysate. Fluorescence images were captured by a fluorescence microscope (Olympus, Tokyo, Japan).
Immunofluorescence
H9c2 cardiomyocytes in 6-well plates were fixed with 4 % paraformaldehyde for 30 min. After that, they were permeabilized in 0.5 % Triton X-100 at 37°C for 20 min, blocked with 5% BSA solution and add NRF2 antibody to incubate overnight at 4°C. Finally, the samples were incubated with Cy3 labeled goat anti-rabbit secondary antibody, followed by 4',6-diamidino-2-phenylindole dihydrochloride (DAPI) (Invitrogen, Carlsbad, CA, USA) staining for 10min, then observed and captured positive areas with a laser confocal microscope (Leica TCS, Germany).
Quantitative real-time polymerase chain reaction (qRT-PCR) analysis
Total RNA was extracted from the myocardial samples and H9c2 cells using Trizol reagent. 2 μg of RNA from each sample was then reverse transcribed into cDNA according to the Prime-Script RT reagent kit instruction(Servicebio, Wuhan, Hubei, China). The qRT-PCR was performed using a SYBR Green qPCR Reagent Kit (Servicebio, Wuhan, Hubei, China) by Bio-Rad CFX Connect Real-Time PCR Detection System (Bio-Rad, USA). The primers used are listed in Table 1. The mRNA levels were normalized to β-actin mRNA level. The expression of genes was analysed by using the 2−ΔΔCT method.
Table 1. The sequences of RT-PCR used in this study
Gene
|
Forward (5′-3′)
|
Reverse (5′-3′)
|
ACSL4
|
CTGCCGAGTGAATAACTTTGGA
|
TCAGATAGGAAGCCTCAGACTCATT
|
NRF2
|
TTGGGGTAAGTCGAGAAGTGTTT
|
ATGTGGGCAACCTGGGAGTA
|
SLC40A1
|
CTAAATCCGTCCCCATAATCTCC
|
CCCATTGCCACAAAGGAGAC
|
β-actin
|
TGCTATGTTGCCCTAGACTTCG
|
GTTGGCATAGAGGTCTTTACGG
|
Western blotting
After different treatments, H9c2 cardiomyocytes and myocardial tissue were homogenized with pre-cooled RIPA lysis buffer. The supernatant was taken and added to the protein buffer. Then, the extracts were placed at 100°C and keep them for 5 min. The total protein was separated by SDS-PAGE gel and then transferred to PVDF membranes. The membranes were incubated with 5% skimmed milk for 1 hour. Primary antibodies (ACSL4, 1:1000; GPX4, 1:1000; NRF2, 1:1000; FPN1, 1:1000; GAPDH, 1:1000) were incubated with the membranes overnight at 4°C. The horseradish peroxidase (HRP) conjugated secondary antibody (1:5000; Proteintech) was incubated for 1 h at room temperature. The final analysis was performed with the biological image analysis system (Bio-Rad, USA). The relative expression levels of the target proteins in each sample were obtained by normalizing these levels against that of GAPDH.
Statistical analysis
All results were analyzed using Graphpad Prism 8.0 software (GraphPad Software, USA) and presented as means ± standard deviation. Statistical analysis was carried out using one-way analysis of variance (ANOVA) and P < 0.05 were deemed significant.