Human OGCs in vitro experiment
The OGCs were from the Embryo Laboratory of the Reproductive Medicine Center of Binzhou Medical College Affiliated Hospital. The subjects of this study were randomly selected from the patients who received in vitro fertilization-embryo transfer (IVF-ET) at the Reproductive Center of the Affiliated Hospital of Binzhou Medical College. Moreover, the OGCs are from patients with PCOS. The control group consisted of OGCs from 30 infertile patients with simple fallopian tube factors and normal ovarian reserve.
Materials
The OGCs were obtained on the day of ooctyte retrieval in the Embryo Laboratory of the Reproductive Center of the Affiliated Hospital of Binzhou Medical College. Simultaneously, thered blood cell lysis method was used to obtain high-purity OGCs. Then, the OGCs were cultured for 3 days to establish an in vitro culture system of human primary OGCs. On the 3rd day, nesfatin-1 and IWR-1 with different concentrations were added. After 24 hours, the granulosa cells were collected and observed. The apoptosis of each group was determined by flow cytometry, as well as the mRNA level was analyzed by qRT-PCR expression of Foxo3a-1, downstream target gene P27, apoptosis-related genes Bax, Caspase-3, Bim, and Bcl-2. In addition, the effect of CCK-8 on the proliferation of OGCs was observed. This study was approved by the Medical Ethics Committee of Binzhou Medical College Hospital and all patients.
OGCs culture in vitro
The granule cell mixture was centrifuged after ooctyte retrieval at 1600r/min for 6 minutes. Then, the supernatant was removed. The red blood cell lysate was added with about three times the volume. They are mixed well, and thus reacting in the dark for 6 minutes. Next, in order to further purify OGCs, they were centrifuged again, and the supernatant was discarded. The remaining part were seeded in a 24-well plate, and OGCs were cultured in DMEM/F12 medium at 37 °C in a humidified atmosphere with 5% CO2 and 95% air. The medium contains 10% FBS (FBS00717-1, Aus Gene X), 100 U/ml penicillin and 100 µg/ml streptomycin. Furthermore, the cell culture medium should be changed every 24 hours. After the OGCs were cultured in vitro for 48 hours, the serum-free culture media, containing0, 1*10− 7M, 1*10− 9M and 1*10− 11M nesfatin-1, respectively, were added to the experimental group and they were cultivated for 24 hours.
Apoptosis detection by flow cytometry
After drug treatment, the OGCs apoptosis was measured by an Annexin V-FITC / PI apoptosis detection kit. Apoptotic cells, which stained positive for Annexin V-FITC, negative for PI, or double-positive, were counted. The data were represented as a percentage of the total cell count.
Granulosa cells viability measurements by cck-8
The viability of OGCs was measured by Cell Counting Kit-8 (CCK-8). Briefly, the OGCs were treated for 24 h by IWR-1 and nesfatin-1 with the with various concentrations of 1*10-7M,1*10-9M,and 1*10-11Mrespectively. Then, the OGCs viability was examined by CCK-8 assay, simultaneously, the absorbance was read at 450 nm.
Real-Time Quantitative Reverse-Transcriptase Polymerase Chain
MiniBEST Universal RNA Extraction Kit (TaKaRa, Kusatsu, Japan) was used to extract total RNA, and RevertAid First Strand cDNA Synthesis Kit (TaKaRa) was used to perform reverse transcription into complementary deoxyribonucleic acid according to the manufacturer's instructions. QRT-PCR was conducted on CFX96TM Real-time PCR detection system C1000 using specific primers (Biotech, Shanghai, China). The gene expression of each set of samples was determined in triplicate, and the results were analyzed with the 2 −ΔΔt formula.
Table 1
qRT-PCR primers in patients
Gene | Forward (5’-3’) | Reverse (5’-3’ ) |
GAPDH | ACAACTTTGGTATCGTGGAAGG | GCCATCACGCCACAGTTTC |
Foxo3a | TCACGCACCAATTCTAACGC | CACGGCTTGCTTACTGAAGG |
Bcl-2 | GGTGGGGTCATGTGTGTGG | CGGTTCAGGTACTCAGTCATCC |
Bax | CCCGAGAGGTCTTTTTCCGAG | CCAGCCCATGATGGTTCTGAT |
Bim | TAAGTTCTGAGTGTGACCGAGA | GCTCTGTCTGTAGGGAGGTAGG |
P27 | CGGCTCATGGGCGACTATC | TGTCTTGGAGGAGGATCGTCC |
Caspase-3 | CATGGAAGCGAATCAATGGACT | CTGTACCAGACCGAGATGTCA |
Materials of rat
Firstly, we purchased thirty six-week-old SD female rats from Jinan Pengyue CO, Ltd. And theirs’ weight was between140gཞ160 g.Then, they were randomly divided into two groups, and each group with 15 rats. One was the PCOS experimental group, and the other one was the control group. All rats were weighted with an electronic scale every three days at 8 am, and they can have food and water freely.
Specimen collection
For the rats in the PCOS experimental group, letrozole (1 mg/kg) with 1% carboxymethyl cellulose (CMC, 2 ml/kg) was given every day by gavage for twenty-one days. At the same time, the rats in the control group should be given 1% CMC with the same volume every day[4]. The rats in each group start fasting 20:00 on the 21st day. Then the rats were injected intraperitoneally with Pregnant Mare Serum Gonadotropin (PMSG,10 IU).After 48h[5], all rats were sacrificed by cervical dislocation. The heart blood was collected for 4ཞ5 ml at once, and then placed in the refrigerator at 4℃ overnight. Next, one side of the ovary was taken away and washed in cold PBS. The other side of the ovary was fixed with paraformaldehyde solution, embedded in paraffin and sectioned.
To measure the estrous cycle of rats
The vaginal discharge of rats on the swab was smeared on a glass slide, and then dried naturally at room temperature. It is essential to add a Ruishi-Jimosa solution A to the glass slide with one minute’s standing under the room temperature. Then, the Ruishi-Jimosa solution B was added dropwise on top of the solution A. Next, they were fully mixed, as well as stained for 7 minutes at room temperature. Finally, the glass slide was rinsed slowly with tap water. Subsequently, the cell morphological changes of vaginal smears were observed with a microscope so as to determine the different stages of the estrous cycle [6].
Determination of serum sex hormones in rat
For the heart blood, the serum sex hormone was determined with the upper serum after centrifugation. The follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), progesterone (P), testosterone(T), nesfatin-1were measured by the Enzyme-linked immunosorbent assay kit (ELISA kit), offered by Shandong Lingjin Biological Technology Co. LTD (Jinan, China)[7].
Observation of ovarian morphology
The paraffin section of ovarian tissue was taken for hematoxylin-eosin (HE) staining. At last, the ovarian morphology and structure of slices were observed under the optical microscope.
Nesfatin-1 and Foxo3a immunohistochemistry
The prepared paraffin sections of ovarian tissue were permeabilized with 1% Triton X-100 in phosphate buffered saline (PBS) for 30 minutes at room temperature, boiled in 100 mm sodium citrate (pH 6.0) three times for 6 minutes each at 5 minutes intervals for antigen retrieval, and then incubated with 3% hydrogen peroxide for 30 minutes to remove endogenous peroxidase followed by blocking in 5% bovine serum albumin at room temperature for 1 hour. The sections were then incubated overnight at 4 °C with the diluted primary antibody of nesfatin-1 (bs-10068R) (1:300) or foxo3a (10849-1-AP) (1:400) in the blocking solution. Following three washes with 0.1% Tween-20 in PBS, the samples were incubated with goat anti-rabbit IgG (PV-9001) in the blocking solution at room temperature for 45 minutes. The stained sections were evaluated under a light microscope.
Isolation and Identification of OGCs
Firstly, the separated ovarian tissue in PBS was transferred to Dulbecco’s modified Eagle’s medium (DMEM). Then, a syringe needle was used to puncture the mature follicles after development. The released oocytes and OGCs were collected. As well as 1 g/L hyaluronidase was added to digest the OGCs and oocytes for separation. After being filtered and centrifuged, and at last, a pre-placed cell slide 24-well cell plate at 2*105/ml was inoculated.
The OGCs were cultured on cover slips. After the specimen was fixed and blocked, the cells were incubated with anti-FSH receptor antibody (bs-0895R) (1:120) at 4 °C overnight. Then, the cells were incubated with goat anti-rabbit IgG for 30 minutes at 37 °C and stained with DAB for 5 minutes at room temperature. The OGCs were washed with PBS for three times for 5 minutes, and finally, they were observed under light microscopy[6].
Real-time fluorescence polymerase chain reaction
After drug intervention, all the RNA in each group was extracted by an RNAiso Plus (Takara, Beijing, China), strictly following the manufacturer's instructions, and then reverse-transcribed into complementary DNA.A high capacity complementary DNA (cDNA) reverse transcription kit (Takara, Beijing, China) was used to convert RNA into cDNA. Moreover, the SYBR® Premix Ex Taq™ (Tli RNaseH Plus) was used to perform the PCR reactions. According to the gene sequence in the Genebank, we designed the following primers through Primer 5.0 (Qingdao MedSci Biological Technology Co., Ltd.)
Table 2
Gene | Forward(5’-3’) | Reverse(5’-3’) |
GAPDH | GGCACAGTCAAGGCTGAGAATG | ATGGTGGTGAAGACGCCAGTA |
Foxo3a | TGCTAAGCAGGCCTCATCTCAA | AGATGGCGTGGGAGTCACAA |
Bcl-2 | GACTGAGTACCTGAACCGGCATC | CTGAGCAGCGTCTTCAGAGACA |
Bax | TGGCGATGAACTGGACAACAA | GGGAGTCTGTATCCACATCAGCA |
Bim | TGTTGACATCCCTATCCCTGACAC | GCAGCAGAATCCAAGCACTGAA |
P27 | CGAATGCTGGCACTGTGGA | CATTCAATGGAGTCAGCGATATGTA |
The OGCs of rat viability were measured by cck-8, and the apoptosis of rat was detected by flow cytometry.
Statistical analysis
Data were analyzed by Graphpad Prism5 software. The experimental data are presented as the mean ± standard deviation. The unpaired Student’s t-test was used to analyze the comparison between the two groups. One-way ANOVA followed by multiple comparison tests was used for comparison among multiple groups. Here, P value is less than 0.05, with a statistical significance.