Animals
Wild-type (WT) (n=20) and Ednrbflex3/flex3 (n=8) mice were purchased from the Institute of Model Animals of Wuhan University (Wuhan, China). Endothelin receptor B-null (Ednrbflex3/flex3) was used on the C57/B6J background. Briefly, after mating Ednrbflex3/+ mice with Ednrbflex3/flex3, the homozygotes (referred to herein as Ednrb−/−) were easily distinguished from the WT and heterozygote littermates (referred to herein as Ednrb+/+ and Ednrb+/−, respectively) by the white fur color and gradually enlarging abdomens (due to absence of ganglion cells at the end of rectum). Ednrb+/+ and Ednrb+/− were normal phenotypes and didn’t develope aganglionosis. Therefore, 20 Ednrb+/+ or Ednrb+/ −animals were randomly assigned to WT group. Total 20 Ednrb−/− animals were obtained in this study which displayed distal colonic aganglionosis involving 5-10 mm of the colon. Naive mice were defined as WT and Ednrb−/− mice without any intervention. According to the manufacturer’s protocols. Briefly, after anesthetized with ether (2-4 %), a 2 mm diameter anal canal was inserted into the anus of the experimental mice, the 5 mice were randomly selected form WT and Ednrb−/− groups were transfected with small interfering RNA (siRNA) duplexes (100 nM) into colon targeting TLR4. TLR4 forward, sense strand: 5'- UUCGAGACUGGACAAGCC -3' and an antisense strand: 5'- UGGCUUGUCCAGUCACGA -3' (20 nM; Guangzhou RiboBio Co., Ltd.) to generate WT + TLR4 siRNA (n=5) and Ednrb−/−+ TLR4 siRNA(n=5) mice groups [13]. The knockdown of TLR4 gene was confirmed at protein level by western blot. The whole experiment lasted for 40 days after mice birth, all experiments involving animals were performed in a specific pathogen-free environment, in accordance with the Zunyi Medical University (Zunyi, China) Guidelines for Animal Care. Animals were kept under a 12-h light/dark cycle with access to food and water.
Ethic Statements
All animal experimental protocols were complied with the Guide for the Care and Use of Laboratory Animals published by the Zunyi Medical University (Zunyi, China). The present study was approved by the Institutional Animal Research Committee of Zunyi Medical University (approval no. IACUC-20191025028; Guizhou, China).
Bacterial Strains And Infection Of Mice
WT, WT + TLR4 siRNA, Ednrb−/−, and Ednrb−/− + TLR4 siRNA mice were infected with 0.1 ml Lb containing 1x109 cfu E. coli JM83 (Jackson Laboratory) by oral gavage to establish the WT + E. coli (n=5), WT + TLR4 siRNA + E. coli (n=5), Ednrb−/− + E. coli (n=5), and Ednrb−/− + TLR4 siRNA + E. coli (n=5) groups. The E. coli JM83 were cultured on trypsin soybean agar plates supplemented with 5% sheep blood (cat no. 21374; BD Biosciences), which was in turn supplemented with 0.2% yeast extract (cat. no. 843; Merck KGaA) at 37˚C with 5% CO2 (durations indicated in individual experiments).
Establishment Of Haec Model
The colon samples from Ednrb−/− + E. coli mice were stored in 4% buffered formalin and embedded with paraffin for subsequent hematoxylin and eosin and immunofluorescence staining analysis to verify the HAEC model. Inflammatory cell infiltration of the crypts (cryptitis and crypt abscesses) was lighter in HAEC mice than in human beings. The severity of HAEC was evaluated according to the modified grading system reported by Porokuokka et al [14] to recently reflect HAEC mice epithelial pathology. Parts of the small bowel (jejunum and ileum) or large bowel (cecum and colon) were excised by separation from the mesentery to prepare a single intestinal cell suspension.
Hematoxylin &eosin (He) And Immunohistochemistry (Ihc)
The colon sections were removed following euthanasia and cut to a thickness of 3 mm, stained with HE and imaged by light microscopy (Nikon Corporation, magnification, x20). The stained section assigned an inflammation score in a blinded manner, as previously described [14]. TLR4 protein expression levels were detected by IHC. The IHC sections were incubated pass the night at 4˚C in primary antibody solution containing anti-human TLR4 antibody (cat. no. A0456; dilution, 2 µg/l, 1:200; OriGene Technologies, Inc.) and a biotin-streptavidin HRP detection system for 12 h, followed by detection with HRP-conjugated goat anti-rabbit IgG secondary antibody (cat. no. 2019629, 1:200; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.). Negative controls were treated with PBS instead of primary antibodies. All sections were observed by an optical microscope (OLYMPUS BH-2; Olympus Corporation, magnification, x100).
Immunofluorescence
For immunofluorescence staining, colon tissue was separated from mice. Colon tissue was fixed in PBS/4% PFA and 10% sucrose solution at 4˚C for 1 h, followed by overnight cryoprotection in PBS/30% sucrose (cat no. 7124; Merck KGaA) for 3 days at 4˚C. Tissue sections were cut into 20-mm sections using a Leica Cryostat Microtome and blocked using a Streptavidin/Biotin Blocking kit (Vector Laboratories, Inc.) and stored at -80˚C until processing. Colon tissue samples were stained with either mouse or rabbit anti-F-actin (cat. no.8927, 1:2,000; Merck KGaA), with the addition of DAPI (cat no. 6982; BioLegend, Inc.). Sections were mounted in a FV1000 laser-scanning confocal microscope (Olympus Corporation, magnification, x20).
Western Blot Analysis
Western blot analysis was performed following the manufacturer's protocol and concentration were measured by the Enhanced Bicinchoninic Acid Protein Assay kit (Beyotime Institute of Biotechnology, Jiangsu, China). Forty µl Proteins were loaded in each well. extracts (120 µl) were mixed with SDS-PAGE (Beyotime Institute of Biotechnology), heated at 90˚C for 5 min. And then transferred to polyvinylidene fluoride membranes. The membranes were blocked with 5% fat-free milk in Tris-buffered saline for 45 min at room temperature. The membrane was the wash with TBST, and then incubated with primary rabbit anti-mouse antibodies anti-TLR4 (1:200, cat. no. ab22048), anti-NF-κBp65 (1:200, cat. no. ab16502), anti-phosphorylated (p)-p38 (1:200, cat. no. ab31828) (all Abcam), anti-p38 (1:200, cat. no. ab2749), and anti-GAPDH (1:200, cat. no. 60004) and mouse anti-rabbit IgG HRP-conjugated (cat. no. sc-2357) (both Beyotime Institute of Biotechnology) at 4˚C for 16 h. The membranes were washed with TBST three times and subsequently incubated with secondary antibodies [TLR4 (1:4,000, cat. no. ab23548), NF-κB (1:4,000, cat. no. ab17893), p-p38(1:4,000, cat. no. ab34620), p38(1:4,000, cat. no. ab28495)] for 2 h at room temperature.
Quantitative Pcr (Qpcr)
For qPCR, total RNA was isolated from colon tissue and macrophages using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacture’s instructions. The NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.) was used for qRNA concentration analysis. qPCR amplification was subsequently performed on an ABI 7900HT Real-Time PCR Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.) to measure the expression of mRNA. The specific primers used were as (Table 1). The qPCR cycle program was: initial denaturation 50˚C for 2 min, 95˚C for 10 min, followed by 40 cycles of 95˚C for 15 sec and 60˚C for 60 sec. Data analysis was calculated by the 2−ΔΔCq method.
Table 1
Primer sequences used for quantitative PCR.
Gene name | Primer sequences (5’-3’) |
Forward | Reverse |
TLR4 | AGCAGAGGAGAAAGCATCTATGATGC | GGTTTAGGCCCCAGAGTTTTTCTCC |
p38 | CGACTTGCTGGAGAAGATGC | TCCATCTCTTCTTGGTCAAGG |
NF-κB | ACATCGTGGTCGGCTTCG | GGGTCACCAGGTACACGTCATT |
GAPDH | GACGGCCGCATCTTCTTGT | CACACCGACCTTCACCATTTT |
ELISA
The levels of IL-10, TNF-α and transforming growth factor β (TGF-β) in colon tissue and cell culture supernatants were measured using commercially available [IL-10 (cat. no.H009), TNF- α (cat. no.H052), TGF-β (cat. no.H034) ELISA kits, according to the manufacturer’s instructions (all Nanjing Jiancheng Bioengineering Inc.).
Statistical analysis
SPSS statistical software package (version 19.0; IBM Crop., Armonk, NY, USA) and Graphpad Prism statistical software package (version 8.0; Graphpad software Inc., La Jolla, CA, USA) were used for statistical analysis. Normally distributed data were presented as the mean ± standard deviation (SD). And statistical analysis were performed using Student’s t-test and one-way ANOVA test. Statistical comparisons of two or more groups with two independent variables were analyzed by two-way ANOVA and a Bonferroni’s post-hoc test. P value <0.05 was considered statistically significant.