Plasmids, yeast and culture conditions
The HA gene (1632 bp) of A/Anhui/1/2013 (AH-H7N9) was PCR-amplified from pCDNA3.1/H7N9/HA using the following primers: HA-F: CTAGCTAGCAATGCAGACAAAATC (Nhe I); HA-R: CCGGAATTCTATACAAATAGTGCACC (EcoR I) and subcloned into the yeast display plasmid, pYD5, which was kindly provided by Dr. Z Wang [11] and allowed the NH2 terminus of the displayed protein of interest to be free. The shuttle plasmid pYD5-HA was transformed into competent Escherichia coli DH5α (New England Biolabs, Beverly, MA) and then electroporated into competent S.cerevisiae EBY100 (Invitrogen, San Diego, CA). Recombinant yeast transformants were grown on selective plate which contained 0.67% yeast nitrogen base (YNB) without amino acids, 2 % dextrose, 0.01 % leucine, 2 % agar and 1 M sorbitol at 30 ℃ for 3 days. Single positive clone S.cerevisiae EBY100/pYD5-HA was selected and cultured in 3 mL of YNB-CAA ( 20 g/L dextrose, 6.7 g/L yeast nitrogen base without amino acids, 13.61 g/L Na2HPO4, 7.48 g/L NaH2PO4 and 5 g/L casamino acids) overnight at 30 ℃ with shaking. Inducible expression of S.cerevisiae EBY100/pYD5-HA was performed in YNB-CAA medium where dextrose was replaced by 20 g / L of galactose at 20 ℃ for 3 days with shaking. Meanwhile, S.cerevisiae EBY100 containing empty pYD5 was used as a negative control for the following tests.
Detection of HA protein expression
1 OD600nm of S.cerevisiae EBY100/pYD5-HA pellets (1 OD600nm ≈ 107 cells) was collected at 72 h post-induction, and washed three times with 500 µL of sterile phosphate-buffered saline (PBS) for Western blotting, immunofluorescence and flow cytometric assay.
For Western blot analysis, 1 OD600nm of S.cerevisiae EBY100/pYD5-HA pellets were re-suspended with 50 µl of 6 × loading buffer and boiled for 10 min. Treated samples were resolved using SDS-polyacrylamide gel electrophoresis and then electrophoretically transferred to nitrocellulose membrane (Bio-rad, Hercules, California, USA). After blocking with 5% non-fat milk at room temperature for 2 h, the blot was probed with a monoclonal mouse anti-HA antibody (1 : 500 diluted) (kindly provided by NIH Biodefense and Emerging Infections Research Resources Repository, Manassas, VA, USA), and incubated overnight at 4 ℃. The membrane was followed by 1 : 5, 000 diluted horseradish peroxidase (HRP)-conjugated anti-mouse IgG (Sigma-Aldrich Corporation, St. Louis, MO, USA) at room temperature for 1 h and developed with the West Pico Chemiluminescent Substrate (Thermo Fisher Scientific Inc., Rockford, IL, USA) and imaged using Molecular Imager ChemiDoc XRS System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Furthermore, 1 OD600 of S.cerevisiae EBY100/pYD5-HA pellets were treated by PNGase F kit (New England Biolabs, Beverly, MA, USA) for detecting N-glycosylation of HA protein.
For immunofluorescence assay and flow cytometric analysis, 1 OD600nm of S.cerevisiae EBY 100 pellets was incubated with a monoclonal mouse anti-HA antibody (1 : 500 diluted) at 4 ℃ for 1 h, and followed by FITC-conjugated goat anti-mouse IgG (1 : 5,000 diluted) at 4 ℃ for 30 min and re-suspended with 500 µL of sterile PBS. Finally, 5 µL of S.cerevisiae EBY100/pYD5-HA pellets were used for immunofluorescence assay (Olympus IX70, Japan), and 300 µL of S.cerevisiae EBY100/pYD5-HA cells were analyzed by flow cytometry analysis (BD FacsCalibur, BD Bioscience, San Jose, CA, USA), respectively.
Quantification of S.cerevisiae EBY100/pYD5-HA expressing HA protein by indirect ELISA
S.cerevisiae EBY100/pYD5-HA expressing HA protein was assayed using a modified, previously published ELISA protocol [12]. Briefly, 10 OD600nm of S.cerevisiae EBY100/pYD5-HA cells (1 OD600nm ≈ 107 cells) were re-suspended in 100 μL of a monoclonal mouse anti-HA antibody (0, 5, 10, 25, 50, 75, 100, 125 and 150 μg/mL) (kindly provided by NIH Biodefense and Emerging Infections Research Resources Repository, Manassas, VA, USA) in PBS containing 1% BSA and incubated at room temperature for 1 h. Then, cells were washed 3 times in PBS. Goat anti-mouse IgG antibody conjugated with horseradish peroxidase (1 mg/ml) (Sigma-Aldrich Corporation, St. Louis, MO, USA) was added and the mixture was incubated at room temperature for 1 h. After washing in the same way, the cells were re-suspended in 100 μL of PBS and subjected to protein surface detection by incubating in 100 μl of HRP substrate 3,3’,5,5’-tetramethylbenzidine (TMB) (Sigma-Aldrich Corporation, St. Louis, MO, USA) in the dark for 30 min followed by addition of 100 μl of 2 mol/L H2SO4 to stop the reaction. The yeast cell suspension was spun down and the supernatant OD450 was measured using a microplate reader. S.cerevisiae EBY100/pYD5 was used a negative control.
Vaccine, animals, immunization and virus challenge
S.cerevisiae EBY100/pYD5-HA cells were harvested at 72 h post-induction and treated by heat-inactivation at 60℃ for 1 h. The final concentration of S.cerevisiae EBY100/ pYD5-HA was adjusted to 1.0 OD600nm/ µL using sterile PBS and stored at 4 ℃ until use.
Eight-week-old female BALB/c mice (Jackson Laboratories, ME, USA) were used for all studies and housed in the specific pathogen-free (SPF) facilities. Mice (n=10 / group) were vaccinated orally with 150 OD600nm of S.cerevisiae EBY100/pYD5-HA on day 1 for prime immunization and boosted on day 14. For comparison, 150 OD600nm of S.cerevisiae EBY 100/pYD5 or 150 µL of PBS was used as a negative control. Mice weights were recorded at pre-immunization and post-immunization.
For the virus challenge experiments, all vaccinated mice were anesthetized and intranasally inoculated with 50 µL of 10 × 50% lethal dose (LD50) A/Anhui/1/2013 (AH-H7N9) virus on day 35 after the initial immunization. Mice were monitored for survival and body weight change for 14 days. At day 3 post infection, mice (n=3 / group) were humanely euthanized, lungs were collected and washed with 1.0 mL of sterile PBS. A TCID50 assay was determined virus titers from clarified homogenates [9]. All
All animal immunizations complied with the Guidelines for Use and Care of Experimental Animal s and were approved by the Animal Committee of the Institute of Southwest Jiaotong University.
All virus challenge experiments with A/Anhui/1/2013 (AH-H7N9) were performed under enhanced biosafety level-3(BLS3)-plus containment facilities.
Enzyme-linked immunosorbent assay (ELISA)
Sera were isolated from blood samples collected at day 13 and 28 after the initial immunization, and stored at -20 ℃ until use. Avidin-biotin system (ABS)-enzyme-linked immunosorbent assay (ELISA) was conducted to measure HA-specific IgG titers, as described previously [13]. Briefly, 96-well microplates (Costar, Corning, NY, USA) were coated with 2 μg / mL of recombinant HA protein, and incubated overnight at 4 ℃. Plates were washed three times with TBS containing 0.05% Tween 20 (TBST) and then blocked with TBST containing 1% bovine serum albumin (BSA) at room temperature for 2 h. 2-fold diluted sera samples were added and incubated at 37 ℃ for 1 h. Bound antibodies were detected using biotinylated goat anti-mouse IgG (1 : 5,000 diluted) and followed by 1 : 1,000 diluted alkaline phosphatase-conjugated streptavidin (R&D Systems, USA). Finally, plates were developed using a pNPP phosphatase substrate (MP Biomedicals, Santa Ana, CA, USA), and the reaction was allowed to develop at room temperature for 25 min and then stopped by adding 50 µL of 2 mol/L NaOH to each well. Optical density (OD) was measured at 405 nm. The IgG titer was determined to be the lowest serum dilution with an OD greater than twice the mean OD of naïve serum plus 2 standard deviations.
ELISpot assay
Capture antibodies mouse IFN-γ and IL-4 cytokines (3 µg / mL in coating buffer, R&D Systems, USA) were coated on the Multiscreen 96-well filtration plates (Millipore, Billerica, MA, USA), respectively. Spleen cells (n=3 / group) were harvested at 2 weeks post prime-boost immunization. Freshly isolated splenocytes (1×106 cells) were cultured on the plate with 100 µL of RPMI 1640 media with 10% FBS, and then stimulated with or without 10 μg / mL of HA-specific peptide (PKGRGLFGAIAGFIENGWEGL) for 36 h in a humidified 37℃ CO2 incubator. After incubation, the plates were washed with sterile PBS and further incubated with biotinylated anti-mouse IFN-γ and IL-4 antibodies (1:5, 000 diluted). After three additional washes, alkaline phosphatase (AP) conjugated streptavidin (1 : 1, 000) was added to each well and incubated at room temperature for 3 h. The plates were washed and developed with BCIP/NBT Chromogen (R&D Systems, USA). The number of IFN-γ and IL-4 secreting cells was counted using an ImmunoSpot ELISpot plate reader (Cellular Technology Ltd, Shaker Heights, OH, USA).
Hemagglutination inhibition (HI) assay
HI assay was performed to assess specific response to HA of H7N9 virus, as described previously [13]. Briefly, sera were treated by Receptor destroying enzyme (RDE) (Denka-Seiken, Tokyo, Japan) at 37 ℃ overnight, and then followed by heat-activation at 56℃ for 45 min. Two fold serial diluted samples (25 µL) in V-bottom 96-well plates were mixed with the equal volume of 4 HA units each well and incubated at room temperature for 30 min. 50 µL of 0.5% (v/v) chicken red blood cells (cRBCs) was added to each well, and hemagglutination was assessed visually after 40 min. The HI titer was expressed as the reciprocal of the highest dilution of the samples and the significant HI titer was greater than 16.
Statistical analysis
A two-tailed Student’s t-test and one-way ANOVA with post-hoc analysis were used when comparing two different groups. A p value less than 0.05 was considered to be significant.