Patient
The ethics committee of Beijing Tiantan Hospital of Capital Medical University approved the study. Written informed consent for participation in the study were obtained from patients’ parents. Blood samples from patient and family members were collected for genetic studies, which were performed in accordance with the Declaration of Helsinki.
Genetic Analyses
Genomic DNA were isolated from peripheral blood samples. Disease-causing mutations were screened using whole genome sequencing (WES) (MyGenostics, Inc.). Candidate mutations were confirmed by Sanger sequencing using the following primers: seq F: 5'-CTGAGACAGCGGGTGCTGGAGG-3', seq R: 5'- GGTCGGAAAGGGTCGGTGGAAA -3' .
Construction of plasmids
Full length human SIK1 cDNA template (NM173354) was purchased from YouBio (G112872), Shanghai China and subcloned to pLVX-Flag lentiviral expression plasmid and 7.1pCMV-3×Flag expression plasmid as wild type SIK1 (WT) using Seamless Cloning kit from Biomed (CL116), Beijing China. p.A294T mutant of SIK1 was generated by PCR method using WT as template. Mutations were confirmed by Sanger sequencing.
Cells
HEK 293T (Human Embryonic Kidney 293 cells transformed by expression of the large T antigen from SV40) (ATCC, CRL-11268) were cultured in Dulbecco's modified Eagle medium (DMEM). SH-SY5Y cells (human ATCC, CRL-2266) were cultured in F12K-DMEM.
Stable cell lines establishment
Lentivirus particles were produced by co-transfected HEK293T cells with pLVX-flag SIK1 WT and mutant plasmids (2.4 ug), packaging plasmids pCMV-VSV-G (800ng, AddGene 8454) and psPAX2 (800ng, AddGene 12260). The medium was changed to fresh DMEM containing 20% FBS at 24 hours post transfection and viral supernatant was collected at 48-72 hours. Then, a total of 1×105 SH-SY5Y cells were infected with viral supernatant supplemented with 8 ug/ml polybrene and incubated for 48 hours. Positive cells were screened by puromycin (4 μg/ml) and each monoclone was confirmed by western blot.
Western blotting
SH-SY5Y cells were harvested and lysed in RIPA buffer (Beyotime, P0013C), containing complete mini protease inhibitor cocktail (Roche, 04693124001). Proteins were separated by SDS-PAGE and transferred to polyvinylidene fluoride membranes (GE, PVDF 0.45UM, 10600023). Non-specific binding was blocked using 5% non-fat milk and the primary antibody was incubated at 4℃ overnight, the secondary antibody (anti-Flag, Sigma F3165) was incubated at room temperature for 1 h. Signals were visualized by chemiluminescence (Millipore Corporation, Billerica, MA, USA).
Cycloheximide Chase Assay
This assay is adapted from previous report(Kao et al., 2015). Briefly, HEK293T cells were plated and transfected with various WT and mutant 7.1pCMV-3×Flag expression plasmids. 24 hours later, cycloheximide was added (1ug/ml) and cells were collected at different time point for western blot detection.
Transcriptome profiling
Three monoclones of SH-SY5Y cells stably-expressing WT or Mutant SIK1 were subjected to whole genome RNA-sequencing. RNA was extracted using Trizol (Invitrogen, 15596-026, USA) according to the manufacturer's protocol. Total RNA was reverse transcribed using a RT-PCR Kit (Tiangen, KR103-03) according to the manufacturer’s protocol. The sequencing reads were generated using the BGISEQ-500 platform following the manufacturer’s recommendations. The paired-end clean reads were aligned to the reference human genome (UCSC version hg19) using TopHat v2.0.12. HTSeq v0.6.1 was used to count the read numbers mapped to each gene and the gene expression levels were calculated with RSEM version v1.2.31 . FPKM of each gene was calculated based on the length of the gene and the read count mapped to that gene. We used MA plot, Volcano plot, Scatter plot and Heatmap plot to show the distributions of DEGs. The Holm’s corrected P-value of 0.005 and log2 (fold change) of 1 were set as the threshold for significant differential expression. Then functional enrichment analysis was performed on GeneOntology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway.
Quantitative real-time PCR
Total RNA was isolated with Trizol reagent (Invitrogen) and then reversed-transcribed with a Reverse Transcription System (Vazyme) following the manufacturer's protocol. The cDNA was amplified by an ABI 7500 Detection System using the AceQ qPCR SYBR Green Master Mix (Low ROX Premixed) (Vazyme) and the primers were listed below:
ARC F
|
AGCGGGACCTGTACCAGAC
|
ARC R
|
GCAGGAAACGCTTGAGCTTG
|
NR4A1 F
|
CCCTGAAGTTGTTCCCCTCAC
|
NR4A1 R
|
GCCCTCAAGGTGTGGAGAAG
|
GABRB3 F
|
GATAAAAGGCTCGCCTATTCTGG
|
GABRB3 R
|
GATCATGCGGTTTTTCACTGTC
|
SCN1A F
|
ATGTGGAAATAGCTCTGATGCAG
|
SCN1A R
|
AGCCCAACTGAAGGTATCAAAG
|
SCN2A F
|
TCTAAGCGTGTTTGCGCTAAT
|
SCN2A R
|
ACCATTCCCATCCAATGAATTGT
|
SCN9A F
|
AGAGGGGTACACCTGTGTGAA
|
SCN9A R
|
CCCAGGAAAATCACTACGACAAA
|
Metabolome profiling
Six monoclones of SH-SY5Y cells stably-expressing WT or Mutant SIK1 were subjected to metabolome profiling. LC-MS analysis were performed using a UHPLC system (1290, Agilent Technologies) with a UPLC HSS T3 column (1.8μm 2.1*100mm, Waters) coupled to Q Exactive (Orbitrap MS, Thermo). The QE mass spectrometer was used for its ability to acquire MS/MS spectra on an information-dependent basis (IDA) during a LC/MS experiment. In this mode, acquisition software (Xcalibur 4.0.27, Thermo) continuously evaluates the full scan survey MS data as it collects and triggers the acquisition of MS/MS spectra depending on preselected criteria(Xiao, Zhou, & Ressom, 2012).
MS raw data (.d) files were converted to the mzML format using ProteoWizard, and processed by R package XCMS (version 3.2). The preprocessed results generated a data matrix that consisted of the retention time (RT), mass-to-charge ratio (m/z) values, and peak intensity. Compound Discover (version 2.0, Thermo) and OSI-SMMS (version 1.0, Dalian ChemDataSolution Information Technology Co. Ltd.) was used for peak annotation after XCMS data processing with mzcloud database and in-house MS database(Wang et al., 2014, Xiao et al., 2012).
The peak number, sample name, and normalized peak area were fed to SIMCA14.1 software package (V14.1, MKS Data Analytics Solutions, Umea, Sweden) for principal component analysis (PCA) and orthogonal projections to latent structures-discriminate analysis (OPLS-DA). PCA showed the distribution of original data. In order to obtain a higher level of group separation and a better understanding of variables responsible for classification, supervised OPLS-DA were applied. 7-fold cross-validation was used to estimate the robustness and the predictive ability of our mode(Wiklund et al., 2008).
Based on OPLS-DA model, a loading plot was constructed, which showed the contribution of variables to the differences between two groups. It also showed the significant variables which were situated far from the origin, but the loading plot is complex because of many variables. To refine this analysis, the first principal component of variable importance in the projection (VIP) was obtained. In addition, commercial databases including KEGG http://www.genome.jp/kegg/ and MetaboAnalyst http://www.metaboanalyst.ca/ were utilized to search for the pathways of metabolites.
Statistical analysis
Samples were compared using two-tailed, unpaired Student’s t-test with GraphPad Prism 7.00. Error bars were represented by SEM. *P < 0.05, **P < 0.01, ***P < 0.001.