Sample collection
Sap from African oil palm (Elaeis guineensis) was procured from palm wine tappers. Sap collection was done following the destructive method described by Onuche et al. [14]. Briefly, the tree was cut down and a cavity created by digging into the soft meristem of the tree trunk. A tube was inserted to make way for sap collection in a sterile plastic bottle. Corn beer was collected with the use of a sterile plastic bottle from corn beer vendors. African oil palm and maize plant were identified at the National Herbarium in Yaounde. The identification was carried out through comparison with the botanic collection of M. Brut No 379 for African oil palm tree, recorded at the National Herbarium No 34163/HNC, while corn beer plant was identified through comparison with the botanic collection of D. Dang No 81 also recorded at the National Herbarium under No 18625/SRF/Cam.
All samples were collected in Buea and immediately transported in ice-cool boxes (4oC) to the University of Buea Life Science Laboratory and allowed for 2 days to undergo fermentation at ambient temperature (21–30 oC) before processing.
Isolation of lactic acid bacteria (LAB)
Media preparation was performed following the manufacturer’s instructions. Tenfold serial dilution was made by transferring 1 ml of each sample into 9 ml of peptone water. The pour plate method was used to enumerate bacteria cells (CFU/ml). Then, 0.1 ml from each dilution was transferred into sterile Petri dishes and covered with molten agar. The plates were incubated at 37oC for 24 h. Repeated sub-culture by streaking on MRS agar was carried out to obtain pure colonies. Pure colonies were labeled with codes, with Pw for palm wine LAB, and Cb for corn beer LAB and Arabic numbers attributed starting from 1. Preliminary identification involving colony morphology, Gram staining, and catalase tests were performed.
Probiotic properties of LAB
The major selection criteria used to determine the probiotic properties of LAB isolates were tolerance to low pH, bile salt tolerance, and in vitro cholesterol assimilation activity. All tests were performed in triplicates and the number of viable colonies in MRS agar plates was counted.
Tolerance to acid pH values
Acid tolerance was evaluated following the method described by Guan at al. [15] with slight modifications. Overnight cultures of bacteria cells were washed three times with PBS (pH 7.0) to remove impurities and centrifuged (Eppendorf centrifuge 5810 R, New York, USA) for 10 min at 4oC at 5,000 rpm. The cell pellets were re-suspended in MRS broth adjusted to pH 2.0 and pH 3.0 (HI991001, Woonsocket, USA) using 3N HCl or NaOH. The cultures were then incubated at 37oC for 24 h. Aliquots were taken after 0 h and 3 h, serially diluted. Samples taken at 0 h were used as the control. Isolates that exhibited final counts ≥ 103 CFU/ml or ≥ 106 CFU/ml at low pH for 3 h, were considered to have moderate or good resistance, respectively. To perform enumeration, 1 ml of each of the suspensions was serially diluted up to the ten logarithmic fold and the viable microorganisms were counted in triplicates on MRS agar.
Bile tolerance
The bile salt resistance of selected isolates was determined by the method described by Argyri et al. [16] with minor modifications. Overnight cultures of bacteria cells were washed three times with PBS (pH 7.0) to remove impurities and centrifuged (5,000 rpm for 10 min at 4oC). The cell pellets were re-suspended in MRS broth containing 0.2 and 0.4% oxgall bile salts (sigma Aldrich, Germany). The cultures were then incubated at 37oC for 24 h. Aliquots were taken after 0 h and 3 h, serially diluted, and plated on MRA agar. Samples taken at 0 h were used as the control. Resistance to bile salt was evaluated based on viable colony counts on MRS agar in triplicates after incubation at 37 oC for 0 and 3 h, reflecting the average time spent by food in the small intestine.
Cholesterol assimilation from culture media
Based on the acid and bile tolerance of the selected strains, the ability of each strain to assimilate cholesterol in vitro was determined by a modified method described by Pereira and Gibson [17]. Bacteria strains were inoculated into tubes, each containing 10 ml of MRS broth, 0.4% bile salts, and 1% acid solution of cholesterol (Sigma-Aldrich, cat # C3045-5G, Germany). The cultures were incubated at 37°C for 24 h. After incubation, the cultures were centrifuged (5,000 rpm for 10 min at 4oC) and the unutilized cholesterol estimated in the supernatant. This was carried out by spectrophotometry (Pharmacia LKB, England) at 540 nm and compared to the control as described by Ngongang et al. [18]. The percentage of cholesterol assimilation was determined by the equation established by Al-Sahel et al. [19]
![](https://myfiles.space/user_files/58653_1b1c6aeb34a62c68/58653_custom_files/img1605215143.jpg)
Where A is the percentage of cholesterol that remained with the pellet, B is the absorbance of the sample containing the cells, and C is the absorbance of the sample without cells.
Isolates having in vitro cholesterol assimilation properties were selected for biochemical identification using API 50 CHL assay.
Identification of LAB isolates
Phenotypic identification of LAB isolates using API 50 CHL kit
Phenotypic identification of LAB isolates was performed by API 50 CHL (API kit, bioMérieux, France) assay. Purified LAB cultures were cultivated in 20 ml MRS broth incubated at 37°C overnight, after which they were washed and re-suspended in API®50 CHL medium (bioMerieux®SA 69280, France). The turbidity of the suspensions was determined by the McFarland method according to the instructions provided by the manufacturer. Cell suspensions were transferred into API 50 CHL strip wells and overlaid with paraffin oil to create an anaerobic condition. The strips were incubated at 37°C. The results were read after 24 h and confirmed after 48 h. Fermentation of carbohydrates was indicated by a yellow color except for the esculine test (black). Color reactions were scored against a chart provided by the manufacture [20]. The results were analyzed with API WEB (bioMerieux) database version 5.0.
Genotypic identification of LAB isolates using 16 S rRNA gene sequencing
Genomic extraction of the two strains of LAB was determined following the method described by Mulaw et al. [21] with some slight modifications.
DNA extraction of LAB isolates
The genomic DNA was extracted from pure cultures of isolate Pw4 and Cb5. One ml of each pure liquid culture was centrifuged at 11,500 rpm for 10 min at 25 0 C (Eppendorf centrifuge 5810 R, New York, USA). The supernatant was decanted and the cell pellets re-suspended into a tube containing 300 μl buffer (10mM Tris-HCl, pH 8.0; 50mM glucose, and 10mM EDTA) and 3 µl lysozyme (10 mg/ml). The pellets were lysed at 37 0 C for 60 min and vortexed every 5 min, followed by placing in ice every 5 min. Threefold (300) µl of lysis buffer and 3 µl RNAse were added to the mixture and incubated for 30 min and cooled on ice for 1 min. Then, 100 µl of 7.5 M solution of sodium acetate was added and vortexed for 25 seconds and centrifuged (Eppendorf centrifuge 5810 R, New York, USA) at 13,000 rpm for 10 min at 4o C. The supernatant was transferred into a sterile tube, and 300 μl isopropanol was added and mixed gently. The resulting mixture was centrifuged at 13,000 rpm for 10 min at 4oC (Eppendorf centrifuge 5810 R, New York, USA). Isopropanol was carefully removed by the use of a sterile Eppendorf pipette without dislocating the DNA pellets. The tubes were air-dried by inverting them on sterile filter paper. The DNA was washed by adding 400 µl of 70% ethanol and centrifuged at 5,000 rpm for 2 min at ambient temperature. The sediments were dried at 37 o C for 10 min and finally dissolved in 30 µl TE buffer and stored at -20 o C for further study.
Amplification of DNA in polymerase chain reaction (PCR)
The 16S rRNA coding region sequence was selected and amplified by PCR using the universal primers- forward (5’- AGAGTTTGATCCTGGCTCAG -3) - reverse (5’- ACGGCTACCTTGTTAACGACTT -3). The PCR conditions for the 30 cycles were as follows: 95oC 5 min (initial denaturation), 94oC for min 30 s (denaturation), 42oC for 1 min 30 s (annealing), 72oC for 1 min 30 s(extension) 72oC for 10 min (and final extension). The PCR amplicons were examined by gel electrophoresis (1%w/v).
Gel electrophoresis
Two µl of each amplification mixture was subjected to electrophoresis in 1.5% (w/v) agarose gels in 0.5 x TAE buffer for 1 h at100 V. The DNA molecular mass marker (250 to 10000 bp) from inqaba biotech, South Africa was used as the standard. After electrophoresis, the gels were stained with ethidium bromide, washed, and photographed with UV transilluminator (Bio-Rad, Hercules, CA, USA). The partial 16S rRNA sequence analysis of the PCR products was sequenced by inqaba biotech, South Africa. The sequences obtained were compared using BLAST (basic local alignment search tool) and submitted to the GenBank sequence database for accession numbers [22]. A phylogenetic tree was constructed using MEGA 10 software to reduce all positions containing gaps and missing data in the trail sequence in order to evaluate the evolutionary relationship of Pw4 and Cb5 and their close relations.
Statistical analysis
All the tests were performed in triplicate, and the results were expressed as mean ± standard deviation. Data were analyzed by the one-way ANOVA plus post hoc Duncan’s test by Statistical Package for Social Scientist (SPSS) version 20.0. Statistical significance was determined at p<0.05. The phylogenetic trees were constructed using MEGA10 (version 10.0).