Bioinformatic analysis of TCGA and GEO datasets
All Level 3 CRC RNASeqV2 mRNA expression profiles were obtained from TCGA (08/26, 2017). The raw CEL files of GSE39582 (Affymetrix HG U133 Plus 2.0 arrays) were downloaded from Gene Expression Omnibus (GEO) and processed using the affy package of BioConductor [10]. Then, the MAS5 algorithm was used for background correction, normalization and summarization of single probes for all probe sets. The identification of differentially expressed genes (DEGs) between subgroups was performed as in our previous studies [7, 8]. Significant DEGs were selected according to a false discovery rate (FDR) adjusted P-value < 0.05 and fold change > 2. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed using the clusterProfiler package from Bioconductor based on the DEGs identified between the HOXC6+ (> median) and HOXC6- (< median) groups [9]. Significantly enriched GO terms and pathways were selected according to a FDR-adjusted P-value < 0.01. Hallmark gene sets from the molecular signatures database (MSigDB) [10] were used to determine whether any signatures were enriched in specific groups by gene set enrichment analysis (GSEA) [11]. Significantly enriched hallmarks were chosen according to a P-value < 0.05.
To quantify the relative amount of distinct lymphocytes in CRC, CIBERSORT [12] was used to calculate the proportions of 22 lymphocytes in tumor tissue. The permutation was set to ≥ 100, and quantile normalization of the input expression mixture was set to FALSE for TCGA RNAseq dataset. Samples with a P-value > 0.05 were excluded from further comparisons. Consensus tumor purity was refined based on a previous systematic pan-cancer measurement of tumor purity [13].
Immunofluorescence (IF) staining and calculation of CD206-positive area
A total of 53 stage II RCC samples collected from Zhejiang University Cancer Institute (ZUCI) were used for IF staining to evaluate the expression of CD206 (a marker of M2 macrophages). Written informed consent was obtained from all patients before enrolment. A primary antibody against CD206 (1:200, HUABIO, ET1702-04) was used for IF staining. ImageJ was used to calculate the CD206-positive area percentage. In brief, the image was separated based on the channels and displayed as 8-bit images. Then, the threshold was adjusted. The areas of DAPI (nuclear location) and CD206 were calculated. The percentage of CD206-positive area was calculated as (CD206-positive area)/(DAPI-positive area).
Cell culture and coculture
The HCT116 and THP-1 cell lines were purchased from ATCC and cultured with RPMI 1640 medium (Gibco) containing 10% fetal bovine serum (FBS, BI Industry). The cells were incubated at 37℃ with 5% CO2. M2 macrophages were generated from THP-1 cells in vitro. Briefly, THP-1 cells were first treated with 200 nM PMA (Sigma-Aldrich, Catalog Number: P1585) for 24 h to differentiate into macrophages. Then, 20 ng/ml IL-4 (Sigma-Aldrich, Catalog Number: SRP4137) and 20 ng/ml IL-13 (PeproTech, Catalog Number: 200 − 13) were added for 48 h to induce M2 macrophages.
Cocultivation of macrophages and HCT116 cells was conducted with the noncontact coculture Transwell system (Corning, USA). Inserts containing 1.0 × 106 THP-1 cells or M2 macrophages were transferred to 6-well plates previously seeded with HCT116 cells (2.5 × 105 cells per well) and cocultured in 1.5% FBS-containing medium for 72 h. HCT116, THP-1, or M2 macrophages were cultured in 1.5% FBS-containing medium as a negative control. After coculture, macrophages, HCT116 cells and culture medium were harvested for use. IL6 was purchased from PeproTech (Catalog Number: 200-06).
Stable gene overexpression using the lentiviral transfection system
LV-HOXC6 (Gene, Shanghai, 24024-1) and negative control lentivirus (CON238) were purchased from GeneChem (Shanghai, China). For infection, 105 cells were plated into 6-well plates and cocultured with 2.5 × 106 transducing-units (TU) virus in the presence of 1X Hitrans G (GeneChem, Shanghai, China) and standard medium. Twelve to15 hours later, the medium was replaced with fresh complete culture medium. After 72 h of transfection, 2 mg/ml or 8 mg/ml puromycin was added to the culture medium for HCT116 selection, respectively. Western blot and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) were utilized to confirm HOXC6 overexpression.
siRNA knockdown
Cells were plated into 6-well plates. After the cells grew to 50–60% confluence, Lipo 3000 (Invitrogen) with specific siRNA (Genepharma, Shanghai) was added to the cells according to the manufacturer’s suggestions. The final concentration of siRNA was 100 nM. Cells were incubated with siRNA for 48 h and then harvested for protein and RNA extraction. The sequences of HOXC6 siRNA were as follows: sense: 5’-GAAAGCCAGUAUCCAGAUUTT-3’ and antisense: 5’-AAUCUGGAUACUGGCUUUCTT-3’. The sequences of IL6 siRNA were as follows: sense: 5’-CCCAGGAGAAGAUUCCAAATT-3’ and antisense: 5’-UUUGGAAUCUUCUCCUGGGTT-3’. The negative control siRNA sequences were as follows: sense: 5’-UUCUCCGAACGUGUCACGUTT-3’ and antisense: 5’-ACGUGACACGUUCGGAGAATT-3’.
Transwell migration assays
Cell migration was examined by Transwell assays without Matrigel. Approximately 104 cells were plated into the upper chamber with RPMI 1640 medium without FBS. RPMI 1640 medium supplemented with 20% FBS was added to the lower chamber. After 48 h of culture for HCT116 cells, the cells in the upper chamber were scarpered, and cells under the upper chamber were fixed with 4% formalin and stained with crystal violet. The migrated cells were counted by light microscopy, and the mean cell number of three random visual fields at a magnification of 200 × was recorded.
Cell proliferation
Approximately 1 × 103 cells were plated into 96-well plates. Cell viability was measured at 1, 3, 5, and 7 days after plating. Cell Counting Kit-8 (CCK-8, Dojindo, Japan, CK04) was utilized for cell viability testing. Cell culture medium was used as a blank control. After 2–3 hours of incubation, an optimal density (OD) value of 450 nm was used to detect cell proliferation. Experiments were carried out in triplicate. Ruxolitinib were purchased from Selleck.
Protein extraction and western blotting
RIPA buffer (Beyotime) with 1% protease inhibitor cocktail (Roche Applied Science) was used for total protein extraction. After quantification of protein concentration and boiling with protein loading buffer, 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gels were used to separate proteins and polyvinylidene fluoride (PVDF) membranes by electrophoresis were used for protein transition. After blocking with 5% nonfat milk, the PVDF membranes were incubated with primary antibodies followed by horseradish peroxidase (HRP)-linked secondary antibodies. Enhanced chemiluminescence (ECL) reagent was used to detect the protein bands. The primary antibodies used for western blotting were as follows: anti-HOXC6 (Santa Cruz, sc-376330), anti-EMT antibody kit (Cell Signaling Technology, #9782), anti-IL6 (Abcam, ab233551), and anti-β-tubulin (Huabio, Hangzhou, M1305-2). β-tubulin was used as a protein loading control.
RNA isolation and qRT-PCR
Total RNA was extracted from HCT116 cells using Trizol following a standard protocol. The Takara PrimeScript TM RT Master Mix Kit (Takara, RR036Q) was used for reverse transcription. The iTaq Universal SYBR Green Supermix (BioRad) and Applied Biosystems 7500 Fast Real-Time PCR System were applied for qRT-PCR. GAPDH was used as the loading control. Experiments were carried out in triplicate. The results were calculated as follows: ΔCT = CT Experimental/NC-CTGAPDH,ΔΔCT = ΔCT Experimental/NC-ΔCT NC, fold change = 2−ΔΔCT. The primers used for qRT-PCR are as follows.
| Forward sequence (5’ to 3’) | Reverse sequence (5’ to 3’) |
HOXC6 | GAGAATGTCGTGTTCAGTTC | GATCTGTCGCTCGGTCAGGCAA |
GAPDH | ATCCCATCACCATCTTCCAG | TGAGTCCTTCCACGATACCA |
CCL2 | AAGATCTCAGTGCAGAGGCTCG | CACAGATCTCCTTGGCCACAA |
CD163 | TTTGTCAACTTGAGTCCCTTCAC | TCCCGCTACACTTGTTTTCAC |
CD206 | GGGTTGCTATCACTCTCTATGC | TTTCTTGTCTGTTGCCGTAGTT |
IL6 | CCTTCGGTCCAGTTGCTTCT | CCAGTGCCTCTTTGCTGCTTTC |
Evaluation of CCL2 by enzyme-linked immunosorbent assay (ELISA)
Approximately 5 × 105 cells were plated into 6-well plates. After the specified treatments according to the manufacturer’s suggestions, the culture medium was harvested simultaneously. Detection of secreted human CCL2 was performed using h.MCP-1 ELISA kit (BOSTER, Wuhan, China, Lot: EK0441) according to the manufacturer’s instructions.
Statistical analysis
All statistical analyses and graphical representations were performed in the R programming language (× 64, version 3.5.1), IBM SPSS Statistics 22 and GraphPad Prism 7 unless otherwise specified.