Animals, experimental endotoxemia, and anti-miRNA treatment
All experiments involving animals were approved by the Animal Care and Use Committee of the Sun Yat-sen University, Guangzhou, China (approval number: 2018007). CCR6 wild-type (WT) and knockout (KO) C57BL/6 male mice were purchased from the Model Animal Research Center of Nanjing University (Nanjing, China). Experimental endotoxemia was induced in 6-week-old mice by intravenous administration of lipopolysaccharide (LPS) from Escherichiacoli (17.5 mg/kg, O55:B5; Sigma-Aldrich, St. Louis, MO, USA); 350 µg LPS in 100 µL of saline was injected. Sepsis was induced by the administration of E. coli (109 colony forming units [CFU]/per mouse; ATCC). Mice were observed every 4 h during the critical stages of the disease, and euthanized with chloral hydrate at predefined endpoints: breathing rate less than 120 breaths per minute, loss of circulation to the tails or feet, or loss of responsiveness to stimuli. Surviving mice were monitored closely for 5 days and euthanized 10 days after injection of LPS. Small intestines were harvested for further analyses 3 days after injection with LPS.
Anti-miRNA treatment was performed as previously described30. Anti-miR-681 oligonucleotide and scrambled negative control (Ambion, Austin, TX, USA) were diluted in invivo-jetPEI solution (Polyplus-transfection) containing 10% (wt/vol) glucose at a ratio of invivo-jetPEI nitrogen residues per oligonucleotide phosphate of 5, according to the manufacturer’s instructions. Solutions were incubated for 20 min at 37°C before injection. Each mouse was administered 400 µL of a saline and oligonucleotide mixture (corresponding to 300 µg of oligonucleotide per dose) daily through tail vein injection for at least 3 days before LPS injection, and continuously for 1–3 days or 5 days after LPS injection. Small intestines were harvested 72 h after the last LPS injection.
Histology, double immunofluorescence staining, and TUNEL analysis
Sections (3 µm thick) from paraffin-embedded intestinal bundles (jejunum) were subjected to hematoxylin and eosin (H&E) staining for histological analysis. For double immunofluorescence staining, immunofluorescence of IL-17 and fluorescence in situ hybridization (FISH) analysis for miR-681 were performed. Briefly, jejuna were harvested to prepare 10-µm frozen sections. Sections were incubated with anti-IL-17 antibody (Abcam, England)at 1:100 dilution overnight at 4°C, followed by incubation with the fluorescent secondary antibody streptavidin Alexa 488 (Invitrogen, Carlsbad, CA, USA) and counterstain with DAPI (Invitrogen). Subsequently, the sections were hybridized with 5’ fluorescein-labeled miR-681 LNA probe or scrambled sequence LNA probe (Exiqon, USA). The hybridization signal was amplified using the tyramide signal amplification system (PerkinElmer, Waltham, MA, USA). Fluorescent images were acquired using the Leica DMI3000B microscope (Leica, Wetzlar, Germany).
TUNEL staining was performed using an in situ cell death detection kit (Roche, Basel, Switzerland), according to the manufacturer’s instructions. The apoptotic index was assessed in full longitudinal sections of villi and intact crypts containing at least 14 cells, including Paneth cells. The average frequencies of apoptosis for villi and crypts were determined in 50 and 100 villi-crypt sections, respectively. Apoptotic index scores are presented as mean ± standard deviation (SD). Three independent observers, blinded to the genotype and treatment, performed the apoptotic index scoring.
Intestinal mucosal scraping and ELISA assays
Jejuna were opened longitudinally on the antimesenteric border to expose the intestinal mucosa. The mucosal layers were harvested by gently scraping with a glass slide for further investigation.
The concentrations of tumor necrosis factor (TNF)-α, IL-6, and IL-10 in the small intestinal mucosa of mice were determined using a commercial ELISA kit (eBioscience, San Diego, CA, USA), according to the manufacturer’s instructions. After incubating with the stop solution, the optical absorbance at 450 nm (570 nm correction) was read on a Microplate Reader (BioTek, Seattle, WA, USA). The values were expressed as pg/mg protein and ng/mg protein.
Cell culture and cell transfections
The human cell line CD4+ cells and HEK293, were obtained from the National Infrastructure of Cell Line Resource (Chinese Academy of Medical Sciences). CD4+ cells were maintained in RPMI1640, supplemented with 10% fetal bovine serum (GeminiBio, USA) at 37°C in a CO2 incubator. HEK293 cells were maintained in DMEM, supplemented with 10% fetal bovine serum (GeminiBio, USA) at 37°C in a CO2 incubator.
Cells were transfected with the anti-miR-681 oligonucleotide (100 nmol/L) and scrambled negative control (Ambion) for 24 h using Lipofectamine 2000 (Invitrogen), followed by stimulation with LPS (100 ng/mL) for 24 h.
Intestinal lymphocyte isolation, flow cytometry, and FACS sorting
Intestinal lymphocytes were harvested as previously described31. Briefly, small intestines were removed, opened longitudinally, and cut into 1-cm pieces. The sections were washed with Hank’s buffered saline and incubated in the presence of 5 mM of EDTA at 37°C for 1 h. After removing the released cells, gut tissues were digested with collagenase IV (100U, Sigma) at 37°C for 1 h and loaded onto a Percoll gradient and centrifuged. The cells between 40% and 100% Percoll were collected and used as intestinal lymphocytes.
Intestinal lymphocytes were mixed with the ammonium chloride lysis buffer (BioSource International, Inc., USA) to eliminate red blood cells and washed with RPMI containing 10% FBS (GeminiBio). For T cell isolation, CD4+ T cell enrichment was performed using magnetic-activated cell sorting beads (Miltenyi Biotec, Bergisch Gladbach, Germany), followed by staining with an anti-CCR6 antibody for detecting miR-681 expression in living Th17 cells or followed by staining with an anti-IL-17 antibody for detecting the number of Th17 cells. In all subgroups of CD4+ T cells, only Th17 cells specifically express chemokine receptor type 6 (CCR6)32–35 and our result has proved that intestinal CD4+/CCR6+ T cells are IL-17-producing T helper cells (Th17 cells) (Supplementary Figure 1).The Becton Dickinson FACSVantage system and MoFlo sorter (DAKOCytomation, Glostrup, Denmark) were used to detect fluorescence and sort cells, respectively.
Immunofluorescence Microscopy
Th17 cells were grown on glass coverslips, 48 hours after split, the cells were fixed with 4% polyformaldehyde for 10 min, and incubated with PBS containing 0.1% Triton X-100 for 3 min. IL-17 were detected with IL-17 antibodies and a Cy3-conjugated (red) secondary antibody (Jackson ImmunoResearch, Langcaster, Pennsylvania, USA). Coverslips were analyzed on the laser confocal fluorescence microscope (Leica TCS SP2, German).
Bacterial cultures
Bacterial detection was evaluated 24 h after LPS injection. To determine the CFU of E. coli, mesenteric lymph nodes (MLNs), spleens, and livers were harvested and homogenized in sterile phosphate-buffered saline (PBS), followed by serial dilutions and plating in Tryptic Soy Agar. The plates were incubated at 37°C for 24 h, and colonies were counted.
Northern blot analysis
The miR-681 probes used for northern blotting were custom-designed and obtained from Shanghai Generay Biotech Co., Ltd. (Shanghai, China) as follows: miR-681, AGCTGCCTGCCAGCGAGGCTG and internal control U6, CACGGGAAGTCTGGGCTAAGAGACA. Northern blotting was performed according to the manufacturer’s instructions. Briefly, 10 µg of total RNA, which was isolated using the Ambion RNA extraction kit (Applied Biosystems, Foster City, CA, USA), was run on a 15% acrylamide-bisacrylamide gel (19:1) containing 7 M urea in Tris-borate-EDTA buffer. Following transfer onto a Hybond membrane (Amersham, Uppsala, Sweden) and ultraviolet crosslinking, the membrane was incubated with the radiolabeled hybridization probe in Ultra-Hyb-oligo hybridization buffer (Ambion). Subsequently, the membrane was washed thoroughly before exposure to X-ray films at -70°C.
Chromatin immunoprecipitation (ChIP)
Analysis of HIF-1α binding to the miR-681 promoter was conducted using a ChIP assay kit (R&D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. The primer sequences of the miR-681 promoter were as follows: forward, TAAGCCAGCAGACACAGTTTAT; and reverse, ATGGTGCCACAACAAGGT.The custom-designed primers were purchased from Shanghai Generay Biotech Co., Ltd. Briefly, after fixation with formaldehyde, cell lysates were harvested and sonicated to shear chromatin. The mixtures were then centrifuged, and the supernatant was used for immunoprecipitation with anti-HIF-1α antibody. After several washes, the resulting immunoprecipitates were used for PCR analysis using the aforementioned primers.
Plasmid constructs and luciferase reporter assay
The human 3′-UTR-Forward or -Reversesequence of the CCR6 gene were cloned into the XbaI/XbaI site of the pGL3 control vector (Promega, Madison, WI, USA). For the luciferase reporter assay, cells were seeded into 96-well plates and transfected with pGL3-CCR6 + miR-681 mimic, pGL3-CCR6, pGL3-control + miR-681 mimic, or pGL3-control, using Lipofectamine 2000 (Invitrogen). After 48 h, cells were harvested, washed with PBS, and subjected to a dual-luciferase reporter assay (Promega), according to the manufacturer’s instructions and using a Lumat LB 9507 luminometer (Berthold, Nashua, NH, USA).
Total RNA extraction and real-time PCR
Total RNA was isolated from tissues and cells using the RNAgents Total RNA Isolation System (Promega), according to the manufacturer’s instructions. Subsequently, 40 ng of RNA was reverse-transcribed into cDNA using the miRNA Reverse Transcription kit (Applied Biosystems). The TaqMan MicroRNA Assay Kit (Qiagen, Hilden, Germany) was used for real-time PCR analyses, using sequence-specific primers for cDNA synthesis and TaqMan probes for real-time PCR.
The expression of miRNAs was normalized to that of the rnu19 gene. Thirty novel miRNAs chosen from mouse embryos29 were quantitatively analyzed. Their sequences are listed in Table 1. All forward primers for miRNAs, shared-reverse miRNAs, and mRNAs were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). The primer sequences of the ten differentially expressed miRNAs were as follows:
miRNA-681: CAGCCTCGCTGGCAGGCAGCT; miRNA-719, forward: ATCTCGGCTACAGAAAAATGTT; miRNA-711, forward: GGGACCCGGGGAGAGATGTAAG; miRNA-33: GTGCATTGTAGTTGCATTGCA; miRNA-16-1: TAGCAGCACGTAAATATTGGCG; miRNA-345: GCTGACCCCTAGTCCAGTGCTT; miRNA-674-5p: GCACTGAGATGGGAGTGGTGTA; miRNA-301: GCTCTGACTTTATTGCACTACT; miRNA-143: GGTGCAGTGCTGCATCTCTGG; miRNA-695: AGATTGGGCATAGGTGACTGAA.
Table 1
Thirty miRNAs from the expression profile of microRNAs in mouse embryos
Name
|
Sequence
|
mmu-miR-678
|
GUCUCGGUGCAAGGACUGGAGG
|
mmu-miR-681
|
CAGCCUCGCUGGCAGGCAGCU
|
mmu-miR-153
|
UUUGUGACGUUGCAGCU
|
mmu-miR-410
|
AGGUUGUCUGUGAUGAGUUCG
|
mmu-miR-30b
|
UGUAAACAUCCUACACUCAGCU
|
mmu-miR-540
|
CAAGGGUCACCCUCUGACUCUGU
|
mmu-miR- 615
|
GGGGGUCCCCGGUGCUCGGAUC
|
mmu-miR- 27b
|
UUCACAGUGGCUAAGUUCUGC
|
mmu-miR-497-3p
|
CAAACCACACUGUGGUGUUAG
|
mmu-miR-370
|
GCCUGCUGGGGUGGAACCUGGU
|
mmu-miR-379
|
UGGUAGACUAUGGAACGUAGG
|
mmu-miR-412
|
UUCACCUGGUCCACUAGCCG
|
mmu-miR-711
|
GGGACCCGGGGAGAGAUGUAAG
|
mmu-miR-719
|
AUCUCGGCUACAGAAAAAUGUU
|
mmu-miR-615
|
UCCGAGCCUGGGUCUCCCUCUU
|
mmu-miR-688
|
UCGCAGGCGACUACUUAUUC
|
mmu-miR-691
|
AUUCCUGAAGAGAGGCAGAAAA
|
mmu-miR-693
|
CAGCCACAUCCGAAAGUUUUC
|
mmu-miR-301
|
CAGUGCAAUAGUAUUGUCAAAG
|
mmu-miR-345
|
GCUGACCCCUAGUCCAGUGCUU
|
mmu-miR-145
|
GUCCAGUUUUCCCAGGAAUCCCU
|
mmu-miR-669b
|
AGUUUUGUGUGCAUGUGCAUGU
|
mmu-miR-695
|
AGAUUGGGCAUAGGUGACUGAA
|
mmu-miR-423
|
AGCUCGGUCUGAGGCCCCUCAGU
|
mmu-miR-337
|
UCAGCUCCUAUAUGAUGCCUUU
|
mmu-miR-682
|
CUGCAGUCACAGUGAAGUCUG
|
mmu-miR-33
|
GUGCAUUGUAGUUGCAUUGCA
|
mmu-miR-16-1
|
UAGCAGCACGUAAAUAUUGGCG
|
mmu-miR-143
|
GGUGCAGUGCUGCAUCUCUGG
|
mmu-miR-674
|
GCACUGAGAUGGGAGUGGUGUA
|
Western blotting analysis
After protein extraction from whole-cell lysates, total protein (50 µg) was mixed with loading buffer containing sodium dodecyl sulfate (SDS) and β-mercaptoethanol and separated using 4–20% gradient SDS-polyacrylamide gel electrophoresis. After electrophoresis, proteins were transferred onto nitrocellulose membranes. Nonspecific binding sites on the membranes were blocked using skimmed milk protein. The membranes were incubated with primary antibodies against HIF-1α, CCR6, CCL20, or β-actin (all from Abcam, Cambridge, UK), followed by incubation with peroxidase-conjugated secondary antibodies. The signal was visualized using enhanced chemiluminescence reagent (Pierce, Rockford, IL, USA). The relative band intensities were determined using Gel-pro Analyzer software (Media Cybernetics, Bethesda, MD, USA).
Statistical analysis
For each experiment, three independent repeats were performed. Data are expressed as mean ± SD. Statistical significance was determined using one-way or two-way ANOVA test for non-paired data or the Mann–Whitney U-test. The statistical significance in the survival analysis was determined by the log-rank test using GraphPad Prism software. A P-value of less than 0.05 was considered statistically significant.