Animals
Mice homozygous for the rd10 mutation (B6.CXBI-Pde6brd10/J) (n = 8) and wild-type C57BL/6J mice (Harlan Laboratories, Barcelona, Spain) (n = 8), half male, half female, were used in the study. Animals were maintained in cages under controlled temperature (23 ± 1 ºC), humidity (60%) and photoperiod (12 h light/12 h dark, 50 lux). Water and food were provided ad libitum. At the end of the study, animals were humanely sacrificed by a lethal dose of sodium pentobarbital. The study has been approved by the Ethics Committee of the University of Alicante (UA-2018-07-06). All procedures were performed in conformity with current guidelines and regulations on the use of laboratory animals (European Directive 2010/63/EU, NIH and ARVO) in an effort to reduce the number of animals used and limit unnecessary animal suffering.
Electroretinographic records
In the morning of postnatal day 32, scotopic ERG responses were recorded bilaterally following previously reported methodology 52. After overnight dark adaptation, animals were anesthetized under dim red light by intraperitoneal administration of 100 mg/kg of ketamine (Imalgene, Merial Laboratorios S.A., Barcelona, Spain) and 4 mg/kg of xylazine (Xilagesic 2%, Laboratorios Calier, Barcelona, Spain), pupils were dilated with tropicamide 1% (Alcon Cusí, Barcelona, Spain), and the eyes were instilled with 0.2% polyacrylic acid carbomer (Novartis, Barcelona) to reduce dehydration and improve electrical connectivity with the recording electrodes (DTL fiber; Sauquoit Industries, Scranton, PA, USA). A reference needle electrode was placed in the head, under the scalp, and a ground electrode was placed in the mouth. During the recordings, into a Faraday cage, stable body temperature (37 ± 0.3°C) and absolute darkness was maintained. Light stimuli (10-ms duration) were presented for at 11 logarithmically increasing luminance (from -5.0 to 1 log cd s/m2) by a Ganzfeld led stimulator. The responses to 3 to 10 consecutive stimuli were averaged for each light intensity. The spacing between flashes was 10 s for dim flashes (-5.0 to -0.8 log cd s/m2) and 20 s for bright flashes (0 to 1 log cd s/m2). A data acquisition board (DAM50; World Precision Instruments, Aston, UK) was used to amplify and band-pass filter the signal (1-1000 Hz, without notch filtering). Stimuli administration and data acquisition (4 kHz) were accomplished using PowerLab-AD system (AD Instruments, Oxfordshire, UK).
Optomotor test
Visual acuity (VA) was assessed in C57BL/6J and rd10 mice, by evaluating optomotor responses in the Argos system (Instead, Elche, Spain). As described previously 52, spatial frequency thresholds were obtained by analyzing the response of the animals to vertically oriented drifting gratings (Fig. 1c). The initial spatial frequency tested was 0.088 cyc/deg and the temporal frequency was 0.8 Hz.
Tissue and stool collection
After ERG recording, animals were sacrificed, and tissue samples were collected. For microbial analysis, colon and ileum segments were removed and stored at -80 °C after quick immersion in liquid nitrogen. For morphological analysis of the retinas, the eyes were enucleated after the placement of a suture to mark the dorsal margin of the limbus. The eyes were then fixed with 4% (w/v) paraformaldehyde for 1 h at room temperature, washed with 0.1 M phosphate buffer (PB, pH 7.4) and cryoprotected through a series of increasing concentrations of sucrose (15, 20 and 30% (w/v)). Following, the cornea, lens and vitreous body were gently removed, the eyecups were embedded in Tissue-Tek OCT (Sakura Finetek, Zoeterwouden, Netherlands), frozen with liquid nitrogen and cut with a cryostat (CM 1900, Leica Microsystems, Wetzlar, Germany). Sections of thickness 16 µm were mounted on glass slides (Superfrost Plus; Menzel GmbH and Co. KG, Braunschweig, Germany) and stored at -20 ºC.
DNA extraction
For the microbiome study, 8 tissue and stool samples were used. Half of them were rd10 and the other half were C57BL/6J, also there were 2 males and 2 females in each group. DNA was extracted from the samples using DNAeasy PowerSoil Pro (QIAGEN, Germany) according to the manufacturer’s protocol, including an extra sample incubation with CD2 at 4 ºC during 5 min before being centrifuged. All centrifugations were carried at 15100 G, minus the one used for removing the residual solution C5, centrifuged at 16100 G.
PCR and sequencing of 16S rRNA gene amplicons
DNA from fecal and colon samples was subjected to amplification of polymerase chain reaction (PCR) using Pro341F (5-’TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCT
ACGGGNBGCASCAG3’) and Pro805R (5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACNVGGGTATCTAATC-3’), targeting the V3-V4 region of 16S rRNA gene. The PCR conditions were: 94 ºC for 3 min, 25 cycles of 94 ºC for 45 s, 51 ºC for 1 min and 72 ºC for 10 min. This was followed by 72 ºC for 10 min. PCR amplicons were cleaned and indexed as indicated in the Illumina’s MiSeq 16S Sequencing Library Protocol and sequenced with Miseq (2 x 300 pb). Sequencing was performed at the Genomics Center (FISABIO, Valencia, Spain).
Microbiome analysis
The sequenced data was quality filtered using prinseq-lite 81, eliminating 0.89% of the reads, with the following parameters min_length: 50, trim_qual_right: 30, trim_qual_type: mean, trim_qual_window: 20 and then joined with FLASH 82, using default parameters producing 814,069 amplicons (Supplementary Table S1). The primers were removed with cutadapt 83, and the cleaned merged reads were analyzed with QIIME2.2020 58. Low quality reads were eliminated with quality-filter q-score, eliminating ≈54 merged reads/ sample. Deblur was used to trim the sequences at position 417 to remove low quality regions 84.
Diversity was studied using the QIIME2 plugin q2-diversity for C57BL/6J-rd10 mice and male-female mice 58. Specifically, alpha-diversity was evaluated with Pielou’s Evenness, Shannon’s Diversity index and Faith’s Phylogenetic Diversity index and compared with the no-parametric Kruskal-Wallis test. Beta-diversity was studied using PERMANOVA with the Bray-Courtis distance, Jaccard distance and weighted Unifrac and unweighted Unifrac distances. PCoAs (--p-metric seuclidean) were performed for representing beta-diversity and for all the taxonomic levels, that were previously collapsed. Taxonomy was assigned with the already pre-formatted SILVA 138 database (reproducible sequence taxonomy reference database management for the masses) 85. The comparison between taxa’s relative abundance to find differentially abundant features was performed with ANCOM 59.
Immunohistochemistry
Immunohistochemical assessment of the retinas was achieved following previously reported methodology 52. Briefly, retinal sections were thawed at room temperature, washed 3 times with PB and incubated for 1 h in 0.1 M PB with 10% (v/v) normal donkey serum and 0.5% Triton X-100. After that, sections were immunolabeled overnight at 4°C under agitation using combinations of primary antibodies at different dilutions in 0.1 M PB with 0.5% Triton X-100: mouse monoclonal anti-rhodopsin (MAB5356, Merk Millipore, Darmstadt, Germany, 1:100), rabbit polyclonal anti-cone arrestin (AB15282, Merk Millipore, 1:200), rabbit polyclonal anti-ionized calcium-binding adapter molecule 1 (Iba1) (019-19741, Wako Chemicals, Richmond, VA, USA, 1:1000) and mouse monoclonal anti-glial fibrillary acidic protein (GFAP) (G3893, Sigma-Aldrich, Steinheim, Germany, 1:500). For objective comparison, rd10 and C57BL/6J retinas were processed in parallel. The slides were washed and then incubated with a mixture of corresponding secondary antibodies at a dilution of 1:100 in PB with 0.5% Triton X-100: AlexaFluor 488-anti-rabbit and AlexaFluor 555-anti-mouse (Invitrogen, Carlsbad, CA, USA). When corresponded, the nuclei marker TO-PRO 3-iodide (Invitrogen) was added at a dilution of 1:1000. Images were acquired on a Leica TCS SP8 confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany).
Measurement of retina outer nuclear layer thickness
In order to assess photoreceptor death in retinal degenerative conditions, the thickness of the outer nuclear layer (ONL) was quantified in at least two non-consecutive sections per retina stained with hematoxylin. Retinal sections included the optic nerve and the temporal and nasal ora serrata. As the progression of the degeneration is not uniform throughout the retina, the quantification was performed every 0.5 mm, at distances of 0, 0.5, 1.0, 1.5, 2.0 and 2.3 mm from the optic nerve toward the periphery.
Statistical analysis
A one-way ANOVA was performed to assess the effects of genotype (rd10 vs. C57BL/6J) on ERG amplitude and ONL thickness, using the IBM SPSS statistics 24 software package (SPSS Inc, Chicago, IL, USA). Post hoc pairwise comparisons were done with the Bonferroni’s test. To assess the effects of genotype on visual acuity, a Mann-Whitney U test was applied. Diversity parameters were statistically evaluated using different QIIME2 tools (https://qiime2.org/): the nonparametric Kruskal-Wallis test was used to compare alpha-diversity whereas beta-diversity was studied using PERMANOVA. The comparison between taxa’s relative abundance was performed with ANCOM 59, which found features that were more abundant in a group as compared with the other. One-way ANOVA was applied to study abundance differences between different taxon levels and ASV numbers using the R statistical software (4.0.2) 86. A p value of less than 0.05 was considered to be statistically significant. All data were plotted as the average ± standard error of the mean.