Laryngeal cancer tissue samples
Specimens from 107 cases of LSCC were collected from the Department of Otolaryngology, Head and Neck Surgery, Xinhua Hospital, Shanghai Jiaotong University School of Medicine between 1997 and 2020. Patients had been diagnosed as LSCC by histopathology. All patients included in this study had no history of radiotherapy or chemotherapy before surgery. The study was approved by the Ethics Committees of Xinhua Hospital. Meanwhile, written informed consent was gotten from the patients or their family.
Immunohistochemistry and TUNEL assay
All tissue samples were obtained from the archives of the department of pathology. Immunostaining for Notch1 was performed on representative 5 µm sections from LSCC tissue blocks. The following primary antibodies were to incubate tissue sections: rabbit anti-Notch1 monoclonal antibody (Epitomics, Inc, Burlingame, California, USA) at 1:100 dilution overnight at 4oC, rabbit anti-Ki-67 polyclonal antibody (BA1508, Wuhan Boster, China) at 1:800 dilution overnight at 4oC. The study was conducted by a two-step immunohistochemistry assay using the DAKO EnVision+System (DAKO, Carpinteria, CA, USA). AI was analyzed by TUNEL assay using an ApopTag Peroxidase In Situ Apoptosis Detection kit (S7100, Chemicon International, Inc., USA).
Evaluation of staining
All samples were independently reviewed by two senior pathologists, without prior knowledge of patients’ information. The immunohistochemical staining of Notch1 was evaluated as mentioned previously [16]. Furthermore, Notch1 protein expression was defined as negative (absent or weak immunostaining) and positive (moderate or strong immunostaining). Ki-67 immunostaining and the apoptosis rate of cancer cells measured by TUNEL method were obtained by reviewing a minimum of 1000 total cancer cells in the representative areas. Then, they were showed as the number of stained nuclei per 100 cells on a 400×objective.
Laryngeal cancer cell lines
The AMC-HN-8 and Tu212 cell lines were both obtained from the Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences. The cells were maintained in Dulbecco's modification of Eagle's medium (DMEM; Gibco Corporation, USA) with 10% fetal bovine serum (Hyclone, USA) and 1% penicillin/streptomycin (Invitrogen). For normoxic condition, cells were cultured in an incubator at 37°C in a humidified atmosphere of 21% O2, 5% CO2, and 74% N2. For hypoxic condition, cells are placed in a hypoxic incubator (NuaireTM US autoflow CO2 water jacketed incubator) at 37°C with 1% O2, 5% CO2 and 94% N2.
Cell transfection
Double-stranded siRNA oligonucleotide targeting Notch1 gene (Notch1-siRNA) (sense: 5'‑CAGGGAGCAUGUGUAACAUTT‑3', anti-sense: 5'‑AUGUUACACAUGCUCCCUGTT‑3') and the scrambled siRNA (sense: 5'‑UUCUCCGAACGUGUCACGUTT‑3', antisense: 5'‑ACGUGACACGUUCGGAGAATT‑3') were synthesized by Shanghai Genepharma Co. Ltd. (China). After 24 hours of culture in antibiotics-free medium, Lipofectamine 2000 was used to transfect siRNA (100 nM) into laryngeal cancer cells. After transfection for 24 hours, laryngeal cancer cells were collected for further research.
Real-time PCR analysis
Total RNA was extracted from laryngeal cancer cells using Trizol reagent (Invitrogen). According to the protocol of reverse transcription kit, the cDNA was reverse-transcribed from the isolated RNA. Primer sequences for PCR were as follows: Notch1 forward, 5'‑CTACCTGTCAGACGTGGCCT‑3' and reverse, 5'‑CGCAGAGGGTTGTATTGGTT‑3'. Hes1 forward, 5'‑TCTGAGCCAGCTGAAAACAC‑3' and reverse, 5'‑GGTACTTCCCCAGCACACTT‑3'. Hey1 forward, 5'‑GGCTCCTTCCACTTACTGTCTC‑3' and reverse, 5'‑ ACTTTCCCCTCCCTCATTCTAC‑3'. GAPDH (internal control) forward, 5'‑CATCTTCCAGGAGCGAGA‑3' and reverse, 5'‑TGTTGTCATACTTCTCAT‑3'. As performed in our previous research [4], Real-time PCR assay used SYBR Green PCR kit (Takara Biotechnology Co., Ltd., Dalian, China) to detect the mRNA expression of Notch1, Hes1, Hey1 and GAPDH genes. Data were analyzed according to the 2−△△CT method [17].
Western blot analysis
Total protein from laryngeal cancer cells was extracted using RIPA lysis buffer. Then, total protein extracts went electrophoresis in SDS-PAGE (5% stacking gel and 8% separating gel) and transferred to PVDF membranes (Millipore), blocked with 5% skimmed milk solution at room temperature for 2 hours. Next, the membranes were immunoblotted with primary antibodies (Notch1 1:1000, rabbit anti-human; N1ICD 1:1000, rabbit anti-human; GAPDH, 1:1000, mouse anti-human) overnight at 4˚C, and incubated with the secondary antibodies (1: 5000; room temperature, 1 hour). The proteins were visualized and quantified by electrogenerated chemiluminescence.
Cell proliferation assay
For the proliferation assay, cells were plated into 96-well culture panels at a dose of 5×103 cells/well. Cell Counting Kit‑8 (CCK‑8) method was used to assess the proliferation of AMC-HN-8 and Tu212 cells according to the manufacturer's protocol. The optical density (OD) was measured at 450 nm on a Microplate Reader (Bio‑Rad Laboratories, Inc.).
Cell apoptosis analysis
The apoptosis index (AI) of neoplastic cells were evaluated by BD FACS Calibur cytometry using Annexin V‑FITC Apoptosis Detection Kit (Bender Medsystems Inc. USA) according to the manufacturer's protocol. Cells were cultured in 6-well plates (4×105 cells/well) and incubated overnight at 37˚C. Then, after renewing the medium, the cells were cultured in hypoxia or normoxia for 48 hours. After that, neoplastic cells were washed in DMEM and resuspended in 190 µL of Tris-HCl buffer. Furthermore, the cell suspension added with 5 µL Annexin-V-FITC and 5 µl propidium iodide. The fluorescence intensity of the stained cells was assessed by FCM.
Statistical analysis
Continuous data were analyzed with Student's t-test or one-way ANOVA analysis. Statistical analyses were processed with SPSS20.0 software. P<0.05 was regarded as statistically significant.