Gametocyte Carriage After Seasonal Malaria Chemoprevention in Plasmodium Falciparum Infected Asymptomatic Children&nbsp;

doi:10.21203/rs.3.rs-110518/v1

Download PDF

Research

Gametocyte Carriage After Seasonal Malaria Chemoprevention in Plasmodium Falciparum Infected Asymptomatic Children

https://doi.org/10.21203/rs.3.rs-110518/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 26 Mar, 2021

Read the published version in Malaria Journal →

You are reading this latest preprint version

Background

Treatment of clinical Plasmodium falciparum malaria with sulfadoxine-pyrimethamine (SP) and amodiaquine (AQ) is associated with increased post-treatment gametocyte carriage. The effect of seasonal malaria chemoprevention (SMC) with SP and AQ on gametocyte carriage was assessed in asymptomatic Plasmodium falciparum infected children.

Methods

The study was carried out in eastern Gambia. Asymptomatic malaria infected children aged 24-59 months old eligible for SMC (SMC group) and children 5-8 years that did not receive SMC treatment (comparison group) were recruited. Baseline gametocyte prevalence was determined by molecular methods before SMC administration and 13 days after. Gametocyte carriage between the groups was compared using the Chi-squared test and within person using conditional logistic regression.

Results

During the 2017 and 2018 malaria transmission seasons, 65 and 75 children were recruited in the SMC and comparison groups respectively. Before SMC administration, gametocyte prevalence was 10.7% (7/65) in the SMC group and 13.3% (10/75) in the comparison group (p=0.64). At day 13 after SMC administration, this was 9.4%, (5/53) for the SMC group and 12.7%, (9/71) for the comparison group (p=0.57). Within the SMC group, gametocyte carriage before and after SMC administration was similar (OR 0.6, 95% CI 0.14 – 2.51) (p=0.48).

Conclusion

In this study with relative low gametocyte prevalence prior to SMC treatment, no evidence was observed that SMC increased gametocyte carriage in asymptomatic malaria infected children.

Infectious Diseases

Gametocyte carriage

Seasonal malaria chemoprevention

Plasmodium falciparum

Asymptomatic

The global malaria burden has substantially reduced over the last two decades owing to the scale up of control interventions [1, 2]. In sub-Saharan Africa, Plasmodium falciparum is the predominant malaria species and remains the focus of control and elimination efforts [2] . Since 2012, the World Health Organisation (WHO) recommends seasonal malaria chemoprevention (SMC) as an additional tool for malaria control where transmission is highly seasonal, primarily the Sahel region of sub-Saharan Africa [3]. SMC is the monthly administration of a full course of sulfadoxine-pyrimethamine (SP) and amodiaquine (AQ) to all children 3 – 59 months old during the 3-4 months of the malaria transmission season regardless of infection status with the goal of reducing malaria morbidity and mortality.

Given that many P.falciparum infections are asymptomatic in both high and low transmission settings [4, 5] and can persist for long periods of time [4, 6, 7] , the systematic administration of antimalarial drugs to the whole population or to high risk groups such as children results in the treatment of such infections. Most available antimalarial treatments clear asexual parasite stages, with incomplete and variable effects on gametocytes [8], the sexual stages responsible for onward transmission to the vector. Treatment of symptomatic patients with SP, AQ, chloroquine (CQ), and piperaquine (PQ) is associated with increased gametocyte carriage and or density [9-14]. Mechanisms such as enhancement of gametocyte production in response to drug-induced stress, release of sequestered gametocytes and up-regulation of gametocyte production in response to subcurative dosage are current hypotheses for the emergence of post-treatment gametocytes [14, 15], that can be infectious to the vector [12-14, 16]. Although the transmission potential of post-treatment gametocytes has been known for about 100 years [17], it has only recently drawn attention in relation to the current drive towards malaria elimination and eradication and the increased knowledge on the differential impact of antimalarials on gametocyte persistence and infectivity [18] .

SMC consists of the monthly administration of SP and AQ over 3 days. Only the first day of treatment (SP and AQ) is directly observed by trained health workers; the other two daily doses of AQ alone are given to care givers to be administered at home, without supervision, with the risk of poor adherence [19, 20] and consequently sub-optimal drug levels in children already infected with malaria. Considering both SP and AQ increase gametocyte carriage in P. falciparum malaria patients [10, 12] coupled with the risk of sub-optimal drug levels triggering gametocytogenesis [15], SMC may increase gametocyte carriage in asymptomatic malaria infected children, possibly resulting in onward transmission to the vector since it is administered during the rainy season when the malaria vector is abundant.

Here, the effect of SMC on post-treatment gametocyte carriage in asymptomatic Plasmodium falciparum infected children was assessed.

Study Setting

This was a prospective study conducted during the 2017 and 2018 malaria transmission seasons in eastern Gambia. Malaria transmission in The Gambia, almost exclusively by P.falciparum, is highly seasonal, occurring mainly during the rainy season (July to October) and shortly after (November to December). Current control activities in the region include prompt diagnosis and treatment, vector control intervention such as indoor residual spraying (IRS) and insecticide-treated nets (ITN), and drug-based interventions such as intermittent preventive treatment during pregnancy (IPTp) and SMC, the latter implemented from 2014 onwards.

Participant’s selection

Potential participants were identified through the health and demographic surveillance system (HDSS) data base of villages with relatively high malaria prevalence (≥20%) according to previous surveys [21]. These were children 24-59 months old and children 5-8 years old. The former represented the SMC group as they are eligible for SMC treatment; the latter were taken as comparison group as they do not receive SMC. Slightly older children were selected as a comparison group because all children within the SMC age group would receive the SMC during the SMC campaigns. The assumption was that baseline gametocyte carriage would not vary between the two age groups [15, 22] .

Screening and Enrolment

At screening, information on medical history was collected and a clinical examination was performed. A dried blood spot (DBS) was collected via a finger prick for the detection of P. falciparum infection by polymerase chain reaction (PCR). Children with asymptomatic P. falciparum infection, without history or evidence of chronic illness and who have not received antimalarial treatment in the previous 2 weeks were enrolled.

Study visits before and after SMC treatment

A visit was conducted by the study team close to the administration SMC (maximum 4 days prior). Demographic information and medical history, particularly any episode of clinical malaria or antimalarial treatment since enrolment was collected. Axillary temperature and body weight were measured and recorded. Approximately 300µL of blood was collected by finger prick into an ethylene diamine tetra acetic acid (EDTA) microtainer tube for molecular detection and quantification of P. falciparum gametocytes. Haemoglobin was measured with a HemoCue® photometer (Ångelholm, Sweden). Parents and care givers were encouraged to participate in the upcoming SMC campaign and to ensure safe keeping of their SMC drug administration records.

The first SMC cycle was implemented by the Gambian National Malaria Control Programme. Briefly, a 3-day course of SP and AQ was administered by to all children aged 3 months to <5 years in the communities. The dose for the first day (SP and AQ) was directly observed by the health worker while that of second and third days (AQ alone) was administered by the caregiver. An SMC distribution card to record all administered doses for every child was issued to care givers.

Study participants were then re-visited by the study team approximately 13 days after the administration of the first SMC cycle. This time interval was chosen to allow for the emergence of gametocytes in the peripheral circulation [23]. History of any episode of clinical malaria or antimalarial treatment since first study visit was collected. Axillary temperature was measured and children with fever (body temperature >37.5ºC) were tested with a rapid diagnostic test (RDT) SD Bioline Malaria Ag P.F (Alere _TM) and if positive were considered clinical malaria cases. An additional blood sample (300µL) was collected by finger prick into an EDTA microtainer tube for molecular detection and quantification of P.falciparum gametocytes. For only the children in the SMC group, information on SMC adherence was collected from care givers. In addition, each child’s SMC administration card was reviewed and information on administered doses as recorded on the card was transcribed on the study case report form.

Sample processing

Blood samples collected in EDTA tubes during both study visits were stored in a cool box and transported to the laboratory within a maximum of 6 hours after collection to maintain ribonucleic acid (RNA) stability [24]; 70µl of whole blood were immediately transferred into 350µl of RNAprotect Cell Reagent (Qigen, Hilden, Germany) and stored at -70ºC. Laboratory staff were blinded to the study group of each sample during analysis. Each set of a participant’s paired samples (i.e. sample for the same participant collected before and after SMC administration) were analysed for gametocytes in the same run to avoid variation in laboratory procedures.

Plasmodium falciparum diagnosis was performed at screening by PCR. Parasite deoxyribonucleic acid (DNA) was extracted from DBS using the QiaAmp DNA minikit (Qiagen, Germany). The var gene acidic terminal sequence (varATS) quantitative PCR was used to detect multi-copy genomic sequences of infections [25]. Briefly, genomic DNA of the parasite was amplified in 20µl reaction containing 1x Taqman mastermix (Life Technologies, United Kingdom) and run in CFX96 Touch™ real-time PCR detection system (Bio-Rad, United Kingdom). The starting quantity values of the parasite samples were estimated against laboratory grown P. falciparum 3D7 standard control (with medonic read of 3.74 x 10⁶erythrocytes/µl and thin film parasitaemia of 1197 parasites/µl of blood).

For P.falciparum gametocytes detection for the samples collected before and after SMC treatment, RNA was extracted using Qiagen’s RNeasy^® Mini kit according to the manufacturer’s recommendations. Pfs25 Quantitative Nucleic Acid Sequence-based Amplification (QT-NASBA) real-time PCR was performed on the extracted mRNAs using the following primers (forward primer: 5’-GACTGTAAATAAACCATGTGGAGA-3’; reverse primer 5’AATTCTAATACGACTCACTATAGGGAGAAGGCATTTACCGTTACCACAAGTTA-3’) and PCR conditions (pre-heat at 65°C; incubate at 65°C for 2 min then 41°C for 2 min; a further 41°C for 46 sec incubation post enzyme introduction). Gametocytaemia was determined using fluorescence amplification time-points in correlation with the standard dilution series that was included in each run [22].

Statistical Considerations

Sample size was calculated assuming baseline gametocyte prevalence of 50% in both the SMC and comparison groups [22]. A sample size of 116 evaluable participants in total, 58 per group, would have 80% power to detect a 25% difference (increase) in gametocyte prevalence between groups at the 5% significance level.

Statistical analysis was performed using STATA software version 16.0 (Stata Corp, College Station, Texas, USA). Descriptive statistics are presented for continuous variables (median (IQR)) and proportions for categorical variables; point estimates are presented with 95% confidence intervals. Analysis was restricted to study participants who remained asymptomatic from enrolment to end of follow up period and took at least the SMC dose for the first day (SP and AQ). The difference in gametocyte prevalence between study groups was assessed using the chi-squared test. Conditional logistic regression, conditional on individuals, was used to predict the odds of gametocyte carriage before and after treatment within each group.

Ethical consideration

This study was approved by the Gambia Government/MRC Joint Ethics Committee (SCC 1563). Children’s parents or legal representative provided written informed consent prior to screening and study participation.

A total of 1,567 children were screened for malaria infection at the beginning of the two transmission seasons (2017 and 2018); 871 children aged 2 to <5 years (SMC group) and 696 aged 5 to 8 years (comparison group). Among these, 65 (7.5%) children in the SMC group and 75 (10.8%) in the comparison group had asymptomatic P. falciparum infection.

Baseline characteristics are as shown in Table 1. Gametocyte prevalence before SMC treatment was 10.7% (7/65) and 13.3% (10/75) for the SMC and comparison groups, respectively. At the end of the follow up, (i.e. a median of 13 days (IQR: 12-13) after SMC treatment), gametocyte prevalence was slightly lower than before SMC treatment, but there was no difference between the SMC (9.4%, 5/53) and comparison (12.7%, 9/71) groups (p= 0.57)(Table 2). In the SMC group, gametocyte carriage tended to be lower after SMC treatment, but this was not statistically significant (OR:0.6, 95%CI:0.14 to 2.51, p=0.48).

Adherence to SMC drug regimen was assessed in 90% (48/53) of children in the SMC group (Fig.2). For all of them, the caregiver reported to have administered the remaining 2 days of treatment. When this information was cross-checked with the SMC drug administration card, only 56.3% (27/48) and 54.1% (26/48) had the doses of the second and third days captured on their cards respectively. A total of 27.1% (13/48) of children were reported to have vomited the dose for the first day shortly after administration while 14.6% (7/48) and 12.5% (6/48) did so for the doses second and third days, respectively.

SP and AQ, the antimalarial drugs deployed for the SMC intervention, are associated with marked increase in gametocytaemia when used to treat clinical cases of P. falciparum malaria [10, 12, 14] . Whether the administration of these drugs would increase prevalence of gametocytes among children with asymptomatic P. falciparum infections receiving SMC was investigated; no evidence of increased gametocyte prevalence was found.

Only a few studies have assessed the emergence of post-treatment gametocytes following treatment of asymptomatic P. falciparum infections and to our knowledge, no study has addressed this question in the context of the SMC. Dunyo et al [26] in a randomized controlled trial (RCT) assessed whether SP increased gametocyte carriage following treatment of asymptomatic P. falciparum carriers that had asexual parasite densities >20 parasites per micro litre but found no evidence of increased gametocyte prevalence or density. However, in that trial, microscopy was used to quantify gametocytes and an increase in gametocytaemia may have been missed since emerging gametocytes typically circulate at or below the microscopic detection threshold [15]. In addition, considering the study by Dunyo et al was a RCT, participants would have received the full treatment dose, with little or no risk of subcurative dosing that could trigger gametocyte production [27]. Conversely, sub-optimal dosage is probable in the context of standard SMC implementation wherein 2 out of the 3 daily doses are administered by caregivers [19, 20] and vomiting of administered doses shortly after administration is common [28]. However, even with the risk of sub-optimal dosaging and the use of sensitive molecular methods for detection of gametocytes in the current study, there was no evidence of increased gametocyte carriage following SMC confirming findings by Dunyo et al [26]. Of note however is that individuals enrolled in the current study had very low parasite densities (geometric mean <1 parasite/uL), representative of typical asymptomatic parasite carriers in low-endemic settings [29]. However, whilst the current study thus had much lower gametocyte prevalence than typically reported in infections with higher parasite densities [29], it has the advantage of including participants that reflect infected individuals among the actual target population of SMC

In the current study population with low parasite density and low baseline gametocyte prevalence, sensitive molecular gametocyte detection methods did not reveal a significant effect of SMC (neither increase nor decrease) on gametocyte carriage shortly after treatment. Perhaps over longer-periods of follow-up, the clearance of asexual parasites, the precursors of gametocytes, may result in lower gametocyte carriage. This result could be enhanced if gametocyte-clearing drugs would be added to the SMC regimen, reducing gametocytes persistence after treatment that was also evident in the current study [18]. Such strategy might confer benefits for malaria transmission in the community.

Adherence to SMC administration as reported by caregivers was 100%, similar to what has been reported from Mali [30]. However, when comparing reported adherence to the information on the SMC distribution card, the second and third doses were not registered in almost half of study participants (Fig.2), suggesting either caregivers’ over-reporting of adherence during the interview or incomplete recording. In a malaria chemoprevention trial in Uganda, drug levels were undetectable in only 52% of cases despite caregivers having reported administering all assigned doses [20], suggesting over reporting. Similarly, a study on SMC uptake in Ghana concluded that up to 20% of children did not receive their second and third days treatments based on the number of tablets found at their homes during household visits [19]. Reported adherence by caregivers is therefore unreliable; possibly all SMC treatment doses should be directly observed by health workers or by trained village health workers, although this approach could pose logistical challenges.

Vomiting occurred more often than expected [28], 27% of children vomited the first treatment dose; although the percentage was lower for the second or third dose, this could be due to under-reporting by the caregivers. Low tolerability may lead to low adherence, resulting in sub-curative doses in malaria infected individuals, with potential risks of selecting for drug resistant parasites [31], emergence of post-treatment gametocytaemia [15] and onward malaria transmission [32]. Sweetened dispersible tablets resulted in higher tolerability in Senegal [33] and should perhaps be adopted as the standard formulation for SMC. Furthermore, provision should be made to compensate for vomited doses, particularly those administered by caregivers at home.

There are some limitations to this study that should be considered. Baseline gametocyte prevalence was lower than expected and this may have affected the power of the study to find a significant difference between SMC and comparison groups. However, there was little difference in gametocyte prevalence before and after treatment in both the SMC group (10.7% versus 9.4%) and the control group (13.3% versus 12.7%), suggesting that SMC is not associated with increased gametocyte carriage in the current study. Secondly, the fitness of gametocytes was not assessed as antimalarial drugs may sterilize gametocytes before clearing them from circulation [34] since gametocyte transmissibility is ultimately more relevant for public health than gametocyte presence. Thirdly, drug concentrations were not measured and thus it is not possible to carry out a more detailed analysis on the effect of suboptimal dosing on post-treatment gametocytaemia. Finally, gametocytaemia was measured only at one time point after SMC treatment and this did not allow for plotting the dynamics of circulating gametocytes over a longer period.

In this low transmission setting, there is no evidence that SMC administered to asymptomatic P. falciparum infected children is associated with higher prevalence of gametocytes. This therefore argues against a possible increase in transmission after SMC thus allaying such concern. However, these findings cannot be generalizable to other settings since factors that could determine the emergence of post-treatment gametocytes, notably asexual parasite density [15] and drug resistance [35], vary across different transmission settings. As SMC is delivered to millions of children across different transmission settings of the Sahel, there is the need to investigate this question in other settings ideally with direct assessments of transmission potential to mosquitoes.

AQ: amodiaquine; CQ: chloroquine; DBS: dried blood spot; DNA: deoxyribonucleic acid; EDTA: ethylene diamine tetraacetic acid; HDSS: Health and Demographic Surveillance System; IPTp: intermittent preventive treatment during pregnancy; IRS: indoor residual spraying; ITN: insecticide treated nets; MRC: Medical Research Council; PQ: piperaquine; PCR: polymerase chain reaction; QT-NASBA: quantitative nucleic acid sequence-based amplification; RCT: randomized controlled trial; RDT: rapid diagnostic test; RNA: ribonucleic acid; SMC: seasonal malaria chemoprevention; SP: sulfadoxine-pyrimethamine; varATS: var gene acidic terminal sequence; WHO: World Health Organization.

Ethics approval and consent to participate: Ethics approvals were obtained from the Gambia Government/MRC Joint Ethics Committee (SCC 1563). Children’s parents or legal representative provided written informed consent prior to screening and study participation.

Consent for publication: Consent for publication of study results and data which do not identify specific individuals was granted by each child’s parent or legal representative when they enrolled for the study.

Availability of data and materials: The data used or analyzed in this study are available from the corresponding author on reasonable request with approval from the Gambia Government/MRC Joint Ethics Committee.

Competing of interests: All authors declare no competing interests.

Funding: This work was supported through the DELTAS Africa Initiative grant DEL-15-010. The DELTAS Africa Initiative is an independent funding scheme of the African Academy of Sciences (AAS)’s Alliance for Accelerating Excellence in Science in Africa (AESA) and supported by the New Partnership for Africa’s Development Planning and Coordinating Agency (NEPAD Agency) with funding from the Wellcome Trust grant 107741/A/15/Z and the UK government. The views expressed in this publication are those of the author(s) and not necessarily those of AAS, NEPAD Agency, Wellcome Trust or the UK government’.

Authors’ Contributors: AA, UDA, and JA designed the study which was performed by AA and MB. AP, BE, and MN performed molecular diagnostic analysis. JB, AA, UDA and TB analyzed and interpreted the data and results. AA wrote the original draft manuscript which was critically reviewed and approved by all authors.

Acknowledgements: We would like to thank the study volunteers who participated in this study. We would also like to thank the staff from the MRCG at LSHTM who provided support during the conduct of the study – Davis Nwakanma, Muna Affara, Serign Ceesay, Musa Jawara Lamin Gibba, Haddy Bittaye, Sainey Ceesay, Babuccar Bittaye, Mavis Foster-Nyarko, Kebba Naban, Sampa Sanneh and the entire field team. We also acknowledge Harouna Soumare and Marta Moreno for initial review the draft manuscript. JB received support from the UK MRC and the UK DFID (#MR/R010161/1) under the MRC/DFID Concordat agreement and as part of the EDCTP2 programme supported by the European Union.

WHO: World Malaria Report 2019. Geneva, World Health Organization, 2019. https://www.who.int/publications/i/item/9789241565721. Accessed October 27, 2020.
Bhatt S, Weiss DJ, Cameron E, Bisanzio D, Mappin B, Dalrymple U, Battle K, Moyes CL, Henry A, Eckhoff PA, et al: The effect of malaria control on Plasmodium falciparum in Africa between 2000 and 2015.Nature 2015, 526:207-211.
WHO: Policy Recommendation: Seasonal Malaria Chemoprevention (SMC) for Plasmodium falciparum malaria control in highly seasonal transmission areas of the Sahel sub-region in Africa. . Geneva, World Health Organization, 2012. https://www.who.int/malaria/publications/atoz/who_smc_policy_recommendation/en/. Accessed October 10, 2020.
Lin JT, Saunders DL, Meshnick SR: The role of submicroscopic parasitemia in malaria transmission: what is the evidence?Trends in Parasitology 2014, 30:183-190.
Bousema T, Okell L, Felger I, Drakeley C: Asymptomatic malaria infections: detectability, transmissibility and public health relevance.Nature Reviews Microbiology 2014, 12:833-840.
Babiker HA, Abdel-Muhsin AM, Ranford-Cartwright LC, Satti G, Walliker D: Characteristics of Plasmodium falciparum parasites that survive the lengthy dry season in eastern Sudan where malaria transmission is markedly seasonal.Am J Trop Med Hyg 1998, 59:582-590.
Lindblade KA, Steinhardt L, Samuels A, Kachur SP, Slutsker L: The silent threat: asymptomatic parasitemia and malaria transmission.Expert Rev Anti Infect Ther 2013, 11:623-639.
Group WGS: Gametocyte carriage in uncomplicated Plasmodium falciparum malaria following treatment with artemisinin combination therapy: a systematic review and meta-analysis of individual patient data.BMC medicine 2016, 14:79-79.
Barnes KI, Little F, Mabuza A, Mngomezulu N, Govere J, Durrheim D, Roper C, Watkins B, White NJ: Increased gametocytemia after treatment: an early parasitological indicator of emerging sulfadoxine-pyrimethamine resistance in falciparum malaria.J Infect Dis 2008, 197:1605-1613.
Checchi F, Piola P, Kosack C, Ardizzoni E, Klarkowski D, Kwezi E, Priotto G, Balkan S, Bakyaita N, Brockman A, Guthmann JP: Antimalarial efficacy of sulfadoxine-pyrimethamine, amodiaquine and a combination of chloroquine plus sulfadoxine-pyrimethamine in Bundi Bugyo, western Uganda.Trop Med Int Health 2004, 9:445-450.
Pasay CJ, Rockett R, Sekuloski S, Griffin P, Marquart L, Peatey C, Wang CY, O'Rourke P, Elliott S, Baker M, et al: Piperaquine Monotherapy of Drug-Susceptible Plasmodium falciparum Infection Results in Rapid Clearance of Parasitemia but Is Followed by the Appearance of Gametocytemia.J Infect Dis 2016, 214:105-113.
Robert V, Awono-Ambene HP, Le Hesran JY, Trape JF: Gametocytemia and infectivity to mosquitoes of patients with uncomplicated Plasmodium falciparum malaria attacks treated with chloroquine or sulfadoxine plus pyrimethamine.Am J Trop Med Hyg 2000, 62:210-216.
Hallett RL, Dunyo S, Ord R, Jawara M, Pinder M, Randall A, Alloueche A, Walraven G, Targett GA, Alexander N, Sutherland CJ: Chloroquine/sulphadoxine-pyrimethamine for gambian children with malaria: transmission to mosquitoes of multidrug-resistant Plasmodium falciparum.PLoS Clin Trials 2006, 1:e15.
Targett G, Drakeley C, Jawara M, von Seidlein L, Coleman R, Deen J, Pinder M, Doherty T, Sutherland C, Walraven G, Milligan P: Artesunate reduces but does not prevent posttreatment transmission of Plasmodium falciparum to Anopheles gambiae.J Infect Dis 2001, 183:1254-1259.
Bousema T, Drakeley C: Epidemiology and infectivity of Plasmodium falciparum and Plasmodium vivax gametocytes in relation to malaria control and elimination.Clin Microbiol Rev 2011, 24:377-410.
Nwakanma D, Kheir A, Sowa M, Dunyo S, Jawara M, Pinder M, Milligan P, Walliker D, Babiker HA: High gametocyte complexity and mosquito infectivity of Plasmodium falciparum in the Gambia.Int J Parasitol 2008, 38:219-227.
Darling ST: Studies in Relation to Malaria Washington Government Printing Office 1910.
Dicko A, Roh ME, Diawara H, Mahamar A, Soumare HM, Lanke K, Bradley J, Sanogo K, Kone DT, Diarra K, et al: Efficacy and safety of primaquine and methylene blue for prevention of Plasmodium falciparum transmission in Mali: a phase 2, single-blind, randomised controlled trial.The Lancet Infectious diseases 2018, 18:627-639.
Antwi GD, Bates LA, King R, Mahama PR, Tagbor H, Cairns M, Newell JN: Facilitators and Barriers to Uptake of an Extended Seasonal Malaria Chemoprevention Programme in Ghana: A Qualitative Study of Caregivers and Community Health Workers.PLoS One 2016, 11:e0166951.
Bigira V, Kapisi J, Clark TD, Kinara S, Mwangwa F, Muhindo MK, Osterbauer B, Aweeka FT, Huang L, Achan J, et al: Protective efficacy and safety of three antimalarial regimens for the prevention of malaria in young Ugandan children: a randomized controlled trial.PLoS medicine 2014, 11:e1001689-e1001689.
Mwesigwa J, Okebe J, Affara M, Di Tanna GL, Nwakanma D, Janha O, Opondo K, Grietens KP, Achan J, D'Alessandro U: On-going malaria transmission in The Gambia despite high coverage of control interventions: a nationwide cross-sectional survey.Malar J 2015, 14:314.
Okebe J, Bousema T, Affara M, Di Tanna GL, Dabira E, Gaye A, Sanya-Isijola F, Badji H, Correa S, Nwakanma D, et al: The Gametocytocidal Efficacy of Different Single Doses of Primaquine with Dihydroartemisinin-piperaquine in Asymptomatic Parasite Carriers in The Gambia: A Randomized Controlled Trial.EBioMedicine 2016, 13:348-355.
Reuling IJ, van de Schans LA, Coffeng LE, Lanke K, Meerstein-Kessel L, Graumans W, van Gemert G-J, Teelen K, Siebelink-Stoter R, van de Vegte-Bolmer M, et al: A randomized feasibility trial comparing four antimalarial drug regimens to induce Plasmodium falciparum gametocytemia in the controlled human malaria infection model.eLife 2018, 7:e31549.
Waltmann A, Karl S, Chiu C, Mueller I: Limited Degradation of the Plasmodium falciparum Gametocyte Marker pfs25 mRNA Exposed to Tropical Temperatures: Considerations for Malaria Transmission Field Studies.The American journal of tropical medicine and hygiene 2016, 94:886-889.
Hofmann N, Mwingira F, Shekalaghe S, Robinson LJ, Mueller I, Felger I: Ultra-Sensitive Detection of Plasmodium falciparum by Amplification of Multi-Copy Subtelomeric Targets.PLOS Medicine 2015, 12:e1001788.
Dunyo S, Milligan P, Edwards T, Sutherland C, Targett G, Pinder M: Gametocytaemia after drug treatment of asymptomatic Plasmodium falciparum.PLoS clinical trials 2006, 1:e20-e20.
Buckling A, Ranford-Cartwright LC, Miles A, Read AF: Chloroquine increases Plasmodium falciparum gametocytogenesis in vitro.Parasitology 1999, 118 ( Pt 4):339-346.
Ndiaye JL, Cissé B, Ba EH, Gomis JF, Ndour CT, Molez JF, Fall FB, Sokhna C, Faye B, Kouevijdin E, et al: Safety of Seasonal Malaria Chemoprevention (SMC) with Sulfadoxine-Pyrimethamine plus Amodiaquine when Delivered to Children under 10 Years of Age by District Health Services in Senegal: Results from a Stepped-Wedge Cluster Randomized Trial.PloS one 2016, 11:e0162563-e0162563.
Slater HC, Ross A, Felger I, Hofmann NE, Robinson L, Cook J, Gonçalves BP, Björkman A, Ouedraogo AL, Morris U, et al: The temporal dynamics and infectiousness of subpatent Plasmodium falciparum infections in relation to parasite density.Nat Commun 2019, 10:1433.
Diawara F, Steinhardt LC, Mahamar A, Traore T, Kone DT, Diawara H, Kamate B, Kone D, Diallo M, Sadou A, et al: Measuring the impact of seasonal malaria chemoprevention as part of routine malaria control in Kita, Mali.Malaria Journal 2017, 16:325.
White NJ: Antimalarial drug resistance.The Journal of clinical investigation 2004, 113:1084-1092.
Challenger JD, Gonçalves BP, Bradley J, Bruxvoort K, Tiono AB, Drakeley C, Bousema T, Ghani AC, Okell LC: How delayed and non-adherent treatment contribute to onward transmission of malaria: a modelling study.BMJ Glob Health 2019, 4:e001856.
Cissé B, Ba EH, Sokhna C, JL ND, Gomis JF, Dial Y, Pitt C, M ND, Cairns M, Faye E, et al: Effectiveness of Seasonal Malaria Chemoprevention in Children under Ten Years of Age in Senegal: A Stepped-Wedge Cluster-Randomised Trial.PLoS Med 2016, 13:e1002175.
Alkema M, Reuling IJ, de Jong GM, Lanke K, Coffeng LE, van Gemert GJ, van de Vegte-Bolmer M, de Mast Q, van Crevel R, Ivinson K, et al: A randomized clinical trial to compare P. falciparum gametocytaemia and infectivity following blood-stage or mosquito bite induced controlled malaria infection.J Infect Dis 2020.
White NJ: The role of anti-malarial drugs in eliminating malaria.Malaria Journal 2008, 7:S8.

Table 1 Baseline characteristics of study participants (N=140)

Characteristic	Group
Characteristic	SMC (n=65)	Comparison (n=75)
Gender (female), n (%)	31 (47.7)	35 (46.7)
Age (years), median (IQR)	3.6 (2.7-4.5)	6.5 (5.2-7.5)
Weight (kg), median (IQR)	12.8 (11.0-14.2)	18.0 (15.5-20.6)
Haemoglobin (g/dL), median (IQR)	10.9 (9.9-12.0)	11.1 (10.0-12.2)
Asexual parasite density (per µL), geometric mean (95%CI)	0.53 (0.16-1.78)	0.59 (0.15-2.36)

Table 2 Differences in gametocyte carriage before and after SMC treatment

Measure

Group

p value

SMC

Comparison

Percentage of gametocyte carriers before SMC treatment

Percentage of gametocyte carriers after SMC treatment

7/65 (10.7%)

5/53 (9.4%)

10/75 (13.3%)

9/71 (12.7%)

0.64*

0.57*

Odd ratio comparing gametocyte carriage before vs after SMC treatment

OR (95% CI)

0.6 (0.14 - 2.51)

0.48^∞

0.9 (0.34 - 2.30)

0.80^∞

* Chi- squared test used to assess between-group difference in proportion of gametocyte carriers

∞ Conditional logistic regression used to determine within-person odds of gametocyte carriage

Download PDF

Journal Publication

published 26 Mar, 2021

Read the published version in Malaria Journal →

Editorial decision: Major Revision
28 Jan, 2021
Review #1 received at journal
22 Dec, 2020
Reviewer #2 agreed at journal
14 Dec, 2020
Reviewer #1 agreed at journal
22 Nov, 2020
Reviewers invited by journal
17 Nov, 2020
Editor invited by journal
16 Nov, 2020
Editor assigned by journal
16 Nov, 2020
Submission checks completed at journal
16 Nov, 2020
First submitted to journal
15 Nov, 2020

You are reading this latest preprint version

Gametocyte Carriage After Seasonal Malaria Chemoprevention in Plasmodium Falciparum Infected Asymptomatic Children

Status:

Journal Publication

Version 1

Abstract

Figures

Background

Methods

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Tables

Status:

Journal Publication

Version 1