Materials
A total of 66 taxa from Bambusa and some other bamboo species (Table 1, all Latin names were obtained from the FOC) representing ten genera were sampled for molecular phylogenetic analysis. There were 50 species from Bambusa belonging to the four subgenera described in the FOC (Xia et al., 2007), including D. oldhamii and Neosinocalamus affinis, which were not accepted as Bambusa in the FRPS, but were moved to Bambusa in 2007 (Xia et al., 2007); they were named B. oldhamii and Bambusa emeiensis, respectively. The outgroup taxa included Dendrocalamus, Phyllostachys, Pseudosasa, Shibataea, Drepanostachyum, Indosasa, Melocanna, Oligostachyum, and Sasa. Fifty taxa from Bambusa were collected and analyzed for morphological phylogeny.
Table 1
Sixty-six taxa from Bambusa and the outgroup.
Name of bamboo | Missing data | Name of bamboo | Missing data |
Bambusa albolineata | | Bambusa pachinensis | |
Bambusa arundinacea | | Bambusa pachinensis var. hirsutissima | |
Bambusa blumeana | | Bambusa pervariabilis | |
Bambusa boniopsis | | Bambusa prominens | |
Bambusa cerosissima | | Bambusa sinospinosa | |
Bambusa chungii | | Bambusa surrecta | |
Bambusa chungii vat. velutina | | Bambusa teres | |
Bambusa cornigera | | Bambusa textilis | |
Bambusa contracta | | Bambusa textilis cv. Gracilis | |
Bambusa corniculata | | Bambusa textilis cv. Purpurascens | |
Bambusa distegia | | Bambusa tuldoides | |
Bambusa dolichoclada | trnH-psbA | Bambusa tuldoides cv. Swolleninternode | |
Bambusa duriuscula | rpl16 | Bambusa ventricosa cv. Nana | |
Bambusa emeiensis/N. affinis | | Bambusa vulgaris | |
Bambusa eutuldoides | | Bambusa vulgaris cv. Vittata | |
Bambusa eutuldoides var. basistriata | | Bambusa vulgaris cv. Wamin | |
Bambusa eutuldoides var. viridi-vittata | | Bambusa xiashanensis | |
Bambusa flexuosa | | Dendrocalamus membranaceus | * |
Bambusa gibba | | Dendrocalamus minor | * rpl16 |
Bambusa gibboides | rpl32-trnL, rpl16 | Dendrocalamus minor var. amoenus | * |
Bambusa indigena | | Drepanostachyum scandens | * |
Bambusa lenta | | Indosasa shibataeoides | * matK |
Bambusa longispiculata | | Melocanna baccifera | * |
Bambusa macrotis | | Neosinocalamus affinis cv. Viridiflavus | * trnH-psbA, rpl16 |
Bambusa multiplex | | Oligostachyum lubricum | * rbcL |
Bambusa multiplex cv. Alphonse-Karr | | Phyllostachys heteroclada | * matK |
Bambusa multiplex cv. Fernleaf | | Phyllostachys heterocycla | * |
Bambusa multiplex cv. Silverstripe | | Phyllostachys praecox | * |
Bambusa multiplex cv. Stripestem Fernleaf | | Pseudosasa amabilis | * rbcL |
Bambusa multiplex var. riviereorum | | Pseudosasa japonica var. Tsutsumiana | * |
Bambusa multiplex var. shimadae | | Sasa auricoma | * |
Bambusa mutabilis | | Shibataea chinensis cv. Aureo-striata | * trnH-psbA |
Bambusa oldhamii / D. oldhamii | * | Sinobambusa tootsik f. luteolo-albo-striata | * |
Marker name in the missing data column indicates that there was an amplification or sequencing failure; * indicates missing morphological character data.
Dna Isolation, Amplification, Cloning, And Sequencing
Leaves were collected from the Hua’an Bamboo Garden (Fujian Province, China) and Lin’an Taihu Lake Source Bamboo Garden (Zhejiang Province, China). Total DNA was extracted from silica-gel-dried young leaves, using a modification of the method described by Fulton et al. (1995). Polymerase chain reaction (PCR) amplification, cloning, and the sequencing of rpl16 were performed according to the forward primer (Cornelia et al., 2007) and reverse primer (Downie et al., 2000), following the protocol of Cornelia et al. (2007). For rpl32-trnL, the primers rpl32-F and trnL were used, following the protocol of Shaw et al. (2007); for rbcL, the primers rbcL-1F and rbcL-724R were used, following the protocol of Fay et al. (1997); for matK, the primers matK-ML and matK-MU were used, following the protocol of Zhu et al. (2015); and for the psbA-trnH region, the primers psbA (Tate, 2002) and trnH2 (Sang et al., 1997) were used, in accordance with the protocol of Tate and Simpson (2003). All the primer sequences are shown in Table 2.
Table 2
Sequences of the five primers used in this study.
MARK | Prime-F | Prime-R |
rpl32-trnL | CTGCTTCCTAAGAGCAGCGT | CAGTTCCAAAAAAACGTACTTC |
rpl16 | CTATGCTTAGTGTGTGACTC | TCTTCCTCTATGTTGTTTACG |
matK | AAACAGAAATCTCGTCAA | AGGGTTCACCAGGTCATT |
rbcL | ATGTCACCACAAACAGAGACTAAAGC | TCGCATGTACCTGCAGTAGC |
trnH-psbA | CGCGCATGGTGGATTCACAATCC | GTTATGCATGAACGTAATGCTC |
PCR was conducted using the TaKaRa Ex™ kit (Takara Biomedical Technology Co., Ltd., Beijing, China) with the following program settings: 5 min at 95.0 ℃; 35 cycles of 30 s at 95.0 ℃, 30 s at annealing temperature, 40 s at 72.0 ℃; 7 min at 72.0 ℃; and then holding at 4.0 ℃. The annealing temperatures used here were 51.0–56.0 ℃. The PCR reaction mixture contained 10 ng of DNA samples, 0.5 µL (10 µM) each of forward and reverse primers, 0.5 µL of deoxyribonucleotide triphosphate (dNTP), 2.5 µL of 10× buffer, and 0.5 µL of deoxyribonuclease (DNase); double distilled water (ddH2O) was added to make the volume up to 25 µL. PCR products were puriଁed using Promega Wizard® PCR Clean-up System kits (Promega Biotech Co., Ltd., Beijing, China) following the manufacturer’s instructions. DNA sequencing was performed commercially by Shanghai Sunny Biotechnology Co., Ltd. (Shanghai, China).
Dna Sequence Alignment And Phylogenetic Analyses
DNA sequences were edited with CHROMAS v2.6.5 and aligned by MUSCLE (embedded in MEGAX), with default parameters. They were adjusted manually where necessary. All sequence data were uploaded to the National Center for Biotechnology Information (NCBI) (https://www.ncbi.nlm.nih.gov/Traces/study/?acc=PRJNA706162&o=acc_s%3Aa). Maximum parsimony (MP) analysis was conducted based on the separate rpl32-trnL, rpl16, matK, rbcL, and trnH-psbA datasets and with a combined rpl32-trnL+rpl16 dataset.
MP analysis was performed with MEGAX (https://www.megasoftware.net/); all characteristics were equally weighted, and gaps were coded as missing data. Heuristic searches of 1,000 random addition replicates were conducted using subtree-pruning-regrafting (SPR) branch swapping. This was done to obtain the most parsimonious trees, and ten trees from each random sequence were saved. Estimates of clade robustness were obtained through bootstrap values (BV) calculated from 1,000 replicate analyses, conducted using the heuristic search strategy and through a simple addition sequence of the taxa. The incongruence length difference (ILD) test of Farris et al. (1994) was used to evaluate the statistical significance of character incongruence among the rpl32-trnL and rpl16 intron datasets before their combined analysis.
Morphological Characteristic Analyses
Based on the China Industry Standard Guidelines for the conduct of tests for distinctness, uniformity, and stability, 186 key morphological descriptors were used to assess Bambusa members. Morphological descriptors were scored as follows: each species was considered as a separate independent operational taxonomic unit (OTU). One hundred and eighty-six key morphological descriptors were used (one root descriptor about aerial root; 22 culm descriptors about powder ring, hair ring, surface cover, color, internode length, diameter, shape, and sheath-node bulge; nine branch descriptors about branch thorn, lowest branch height, and leaf number; six leaf descriptors for length, hair, and base shape; 18 culm descriptors for sheaths about surface cover, hair ring, brim hair, length and color streak; 50 descriptors for sheath auricles about length, the length ratio value of the two auricles, corrugated fold, shape, oral setae length, root location, and extension condition; 54 sheath blade descriptors about shape, reflex, corrugation, hairy, color, tip shape, base length, and length; and 26 sheath ligule descriptors about length, shape, eyelash, and eyelash length). The specific morphological characteristics that were selected are listed in Table 3, which were assessed from each of the 50 OTUs (five replications per OTU) studied in the field. Mean values obtained from five independent replications were used as representative OTU data for each quantitative morphological descriptor. If the sample characteristics conformed to descriptors, they were marked as “0”; if not, they were marked as “1.” The scored qualitative and quantitative interval data were standardized to construct a dendrogram using neighbor-joining (NJ) performed via PowerMarker V3.25.
Table 3
Morphological descriptors.
Organ | characteristics | Comments |
Root | Aerial root | |
Culm (infancy) | With a ring of white powder below sheath scars | |
Covered with white powder | |
Covered with hairs | |
Covered with tomenta | |
Covered with setae | |
With a ring of tomenta below culm node | |
Color: green | |
Color: green with yellow in concave | |
Color: green and yellow | |
Color: yellow with green in concave | |
Color: yellow with few green streak | |
Color: colorful streak | |
Internodes 0-30 cm long at 2 m high | Include 30 cm |
Internodes 30-50 cm long at 2 m high | |
Internodes over 50 cm long at 2 m high | Include 50 cm |
Internodes terete | |
Sheath-node raised inconspicuously | |
Sheath-node raised slightly | |
Sheath-node raised obviously | |
0-3 cm in diam | Include 3 cm |
3-8 cm in diam | |
Over 8 cm in diam | Include 8 cm |
Branch | With thorn | |
With soft thorns | |
With hard thorns | |
Branching from lowest nodes 0-1.3 m above ground | Include 1.3 cm |
Branching from lowest nodes 1.3-2.6 m above ground | |
Branching from lowest nodes over 2.6 m above ground | Include 2.6 cm |
Ultimate branchlets with 0-5 leaves | |
Ultimate branchlets with 6-9 leaves | |
Ultimate branchlets with over 10 leaves | Include 10 leaves |
Leaf | Length: 0-10 cm | Include 10 cm |
Length: 10-20 cm | |
Length: over 20 cm | Include 20 cm |
Abaxially hairy | |
Leaf base shape: wedgy | |
Leaf base shape: olivary | |
Culm sheath | Covered with hair | |
Covered with white powder | |
Covered with with sport | |
with a ring of tomenta below sheath scars | |
Brim with hair | |
Length shorter than internodes | |
Length equal with internodes | |
Length over than internodes | |
colorful streak | |
Sheath auricle | Length: inconspicuous | |
Length: below 1 cm long | |
Length: 1-3 cm long | |
Length: 3-5 cm long | |
Length: over 5 cm long | |
Two auricles equally | |
Two auricles length ratio value between 1.1-2 | |
Two auricles length ratio value between 2-3 | |
Two auricles length ratio value between 3-4 | |
Two auricles length ratio value over 4 | |
Corrugated fold | |
Shape: half-circle | Only at 1.3 m above ground |
Shape: nearly cone | Only at 1.3 m above ground |
Shape: ovoid | |
Shape: long ovoid | |
Shape: threadiness | |
Oral setae length: 0-0.5 cm | |
Oral setae length: 0.5-1.4 | |
Oral setae length: over 1.5 cm | |
Oral setae straight | |
Auricles root and sheath blades separatly | |
Auricles root and sheath blades linked | |
Auricles and sheath blades linked | |
No extension | |
Auricles shouter than half extension | |
Auricles longer than half extension | |
Sheath blade | Shape: triangular | |
Shape: lanceolate | |
Erect (<90°) | |
Reflexed (ca. 90°) | |
Reflexed (>90°) | |
Straight without corrugation | |
Corrugation at 1/3 tip | |
Corrugation at 1/3-1/2 tip | |
Corrugation at 1/1-2/3 tip | |
Corrugation at whole blade | |
Abaxially hairy | |
Ventral hairy | |
Color: green | |
Color: green and purple | |
Color: colorful | |
Color: deadgress | |
Tip shape: long | side over base less than 2 |
Tip shape: lacuminate | side over base equal to ca. 2 |
Tip shape: equilateral triangle | side over base equal to ca. 1 |
Culm sheath top length / sheath blade base length = 1-1.4 | |
Culm sheath top length / sheath blade base length = 1.5-2.4 | |
Culm sheath top length / sheath blade base length = 2.5-3.4 | |
Culm sheath top length / sheath blade base length = 3.5-4.4 | |
Culm sheath top length / sheath blade base length > 4.5 | |
Sheath clade length / culm sheath length < 1 | |
Sheath clade length / culm sheath length = 1 | |
Sheath clade length / culm sheath length > 1 | |
Sheath ligule | Length: 0-2 mm | |
Length: 2-4 mm | |
Length: over 4 mm | |
Entire brim with hair (eyelash) | |
With slender eyelash | |
With thick eyelash | |
Eyelash 0-4 mm long | Include 4 mm |
Eyelash 4-8 mm long | |
Eyelash over 8 mm long | Include 8 mm |
Entire brim without hair | |
Shape: sunken | |
Shape: flat | |
Shape: bulge | |
Characteristics of the culm sheath, sheath auricle, sheath blade, and sheath ligule were recorded at 1.3 and 2.0 m above ground, respectively, as two OTUs, except for the characteristics that have specific comments. Total characteristics comprised 186 OTUs.