Patients and samples
The Ethic Committee of The Second Affiliated Hospital of Nanjing Medical University approved this research. 116 cases of formalin-fixed paraffin-embedded (FFPE) lung adenocarcinoma samples together with adjacent nontumorous lung samples were chosen from LAC patients who underwent surgical resection in The Second Affiliated Hospital of Nanjing Medical University during April 2011 to April 2017. All cases performed lobectomy and radical lymph node dissection. Additionally, 26 cases of fresh-frozen LAC samples and adjacent nontumorous lung samples were collected from the Department of Surgery and used for further qRT-PCR assay. None of the enrolled patients had distant metastasis. All the experiment samples used in our study has been confirmed through histopathology examination.
Consent for publication
Written informed consent documents were obtained for all enrolled patients.
RNA extraction and qRT-PCR
For mRNA analysis, we firstly extracted mRNA from fresh-frozen tissues following the manual procedure. Then, the isolated mRNA was used to perform reverse transcription through the high-capacity cDNA reverse transcription kit (Thermo Fisher Scientific, USA). After reverse transcription, the cDNA products were used for RT-qPCR assay through the SYBR Green PCR Master Mix (Thermo Fisher Scientific, USA) following the standard procedure [16]. We choose GAPDH as endogenous reference gene, and the used primers (ordered from ORIGENE) were as following:
SPRR1B-Forward: 5′- CTGCCCTTCAATAGTCACTCCAG -3′
SPRR1B-Reverse: 5′- CTCATACGCAGAATGGGATAGGG -3′
GAPDH-Forward: 5′- GTCTCCTCTGACTTCAACAGCG -3′
GAPDH-Reverse: 5′- ACCACCCTGTTGCTGTAGCCAA -3′
Immunohistochemistry (IHC) staining
IHC staining was performed to detect SPRR1B protein level following the manufacturer instructions. The fixed samples were firstly embedded in paraffin and sectioned at 8 μm. Slide sections were next dried and deparaffinized, then taken for antigen retrieval in the citrate buffer. Then, slide sections were blocked and incubated with the primary SPRR1B antibody (Cat. No. ab123237; Abcam) at 4°C for 12 hours. Finally, the slide sections were washed and incubated with secondary antibody and substrates were used to observe the immunoreactivities. Negative control was set up by using PBS instead of primary antibody [17].
Evaluation of IHC staining
Two independent pathologists examined the staining results at a 400 X magnification from five randomly selected fields. IHC staining intensity score was classified into four different levels as followings: 0 = negative, 1 = weak, 2 = intermediate, and 3 = strong. The proportion of positive cells was scored as followings: 0 (< 25%); 1 (25% - 50%); 2 (50% - 75%); 3 (> 75%). Finally, the total score of IHC staining (IHCS) was calculated by multiplying these two scores (ranging 0-9).
Cell line culture and siRNA transfection
Human bronchial epithelial cell (HBE) and human lung adenocarcinoma cell lines (H1299 and A549) were obtained from the American Type Culture Collection (ATCC, Rockville, USA). A549 cells were transfected with siRNA by using Lipofectamine RNAi Reagent (Thermo Fisher Scientific, USA) according to the manufacturer’s instructions [18]. The sequences of SPRR1B-siRNAs were designed and synthesized using the BLOCK-it RNAi designer system (Life Technologies) [19] with scrambled siRNA (5′- GCAAACAUCCCAGAGGUAU -3′) as control.
Western blot
Cultured cells were harvested with cold lysis buffer supplemented with protein inhibitors. Then the lysates were collected and centrifuged at 12,000 g for 30 min to obtain the supernatants. After protein quantification, the supernatant was denatured in loading buffer and same amount of proteins were resolved by SDS-PAGE and then electro-transferred onto the PVDF membrane for immunoblotting. The signals were finally detected by western blotting substrate. Primary antibodies targeting SPRR1B and GAPDH were both purchased from Abcam.
Cell proliferation assay
A549 cells were transfected with siRNA and 24 hours later the transfected cells were digested and seeded into 96-well cell-culture plates (3000 cells/well). After cultured for designated time points, the medium was removed and 100μl MTT solution were added and incubated the cells at 37°C for 4 hours. Then the solution was discarded and 200μl DMSO was added to each well. Finally, the plates were shaken for 15min and send to the microplate reader to measure absorbance at 490nm wavelength [20].
Statistical analysis
We conducted the statistical analyses using the software SPSS Statistics 19.0. The association between SPRR1B protein level and clinical characteristics were evaluated through Chi-square method. Kaplan–Meier analysis and log-rank test were used to analyze and plot the overall survival curves of enrolled LAC patients. Independent prognostic factors were identified by using multivariate analysis model [21]. P<0.05 was considered statistically significant.