Patient samples
A total of 702 glioma samples from TCGA (The Cancer Genome Atlas) were used in this study, including 530 low-grade gliomas and 172 glioblastomas. The data related to the changes in the binding of EZH2 and H3K27me3 proteins in the PPARΑ promoter region in glioma samples of different grades were obtained from the GEO database (GSE126396).
Cell culture
The human GBM cell lines U87 and U251 were purchased from ATCC (Manassas, Virginia, USA) in August 2015. After obtaining the U87 and U251 cell lines, they were immediately proliferated and frozen in liquid nitrogen for subsequent studies. U251 cells were cultured in complete MEM (Gibco) medium, while U87 cells were cultured in DMEM (Gibco) medium containing 10% FBS at 37 °C in 5% CO2 incubation. With the exception of in vivo cultures, all glioblastoma cells were maintained for less than eight generations.
GO analysis, survival curve plot and heat map
GO analysis was performed using the Cluster Profiler [11] R package. A survival curve plot was performed using the survminer (https://github.com/kassambara/survminer/issues) R package. Heat map plots were built using cluster 3.0 (Stanford University).
Western blot analysis
Protein was extracted from cells that were seeded without FBS and were treated with drugs following a concentration gradient for 24 h. Equal amounts of total protein (nucleoprotein) per lane were separated using 10% or 15% SDS-polyacrylamide gel electrophoresis and then transferred to a PVDF membrane. The membrane was blocked in 5% skim milk for 1 h and then incubated with primary antibody for 2 h. The primary antibodies used were anti-H3K27me3 (Cell Signaling Technology, USA), anti-PPARα (Proteintech) and anti-GAPDH (Proteintech). Detection of protein bands was performed using a Super Signal protein detection kit (Pierce, USA). The band densities of specific proteins were quantified after normalization to the density of the GAPDH band.
Analysis of wound healing and perforation migration
U87 and U251 cells were infected with control or lentivirus containing si-HOTAIR segment, and then fenofibrate (Sigma-Aldrich) was introduced to treat the cells at a concentration of 100 μM or not. Cells in each group (control, si-HOTAIR, si-HOTAIR+fenofibrate) were seeded into 6-well plates. After 24 hours, a 200 μl sterile pipette tip was used to evenly scrape a single layer cells. The cell debris was removed by washing with PBS (phosphate buffered saline). Then, the cells were incubated with serum-free medium under normal conditions. Photos were taken at 0 and 48 hours after scratching. The wound area was evaluated by ImageJ, and the percentage of wound healing was calculated as follows: (0 hour wound area-48 hour wound area) / 0 hour wound area × 100.
For the in vitro migration assays, U87-control, U87-si-HOTAIR, U87-si-HOTAIR+fenofibrate, U251-control, U251-si-HOTAIR, U251- si-HOTAIR+fenofibrate cells were seeded into the upper culture chamber of a 24-well transwell plate. The medium in the upper chamber contained no serum, and the medium in the lower chamber contained 10% FBS. After incubation at 37 ℃ for 48 hours, non-migrating cells on the upper surface of the membrane were removed with a cotton swab. Cells that passed through the membrane were fixed with methanol, stained with crystal violet, and counted in 5 random fields under an optical microscope (100x magnification).
Colony formation test
After treated U87 and U251 cells with control, si-HOTAIR or si-HOTAIR+fenofibrate, they were inoculated into 6-well plates and incubated. After 14 days, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. We used a digital camera to capture pictures from different transfected colonies (more than 50 cells per clone).
Chromatin immunoprecipitation (ChIP) and ChIP-qPCR assays
ChIP assays were performed using a commercially available ChIP Assay Kit (Beyotime). The ChIP-qPCR primers used were as follows: Forward-1: AACCTTGGGAGCCCCAAAAA and reverse-1: GTGCAGAGTGGTCACGTACA; Forward-2: GAGCGTGGTTTCCCAGAAGA and reverse-2: TTTGGGGCTCCCAAGGTTTT; Forward-3: TACGTGACCACTCTGCACAC and reverse-3: CCTCCGGGCTCAAAGACATT; forward-4: TACGTGACCACTCTGCACAC and reverse-4: CCTCCGGGCTCAAAGACATT.
Nude mouse intracranial glioma model and in vivo bioluminescence imaging
BALB/c-A nude mice were purchased from the Animal Center of Cancer Institute of Chinese Academy of Medical Sciences (Beijing) and their care was in accordance with institution guidelines. Three to five weeks old mice were selected as the intracranial tumor model. U87 and U87-si-HOTAIR cells (5 × 105) were stereotactically injected into the right striatum of nude mice. Seven days after injection, 200 mg/kg of fenofibrate suspended in 5% sodium carboxymethylcellulose were given daily via intragastric administration in treatment group, while the equal volume of 5% sodium carboxymethylcellulose was administrated in the control group. The treatment lasted 21 days. The growth of intracranial tumors was monitored on days 7, 14, 21, and 28 using a bioluminescence imaging system.
Histopathology
The whole brains of the mice were harvested on day 28 after allogeneic glioma cells were implanted, fixed in 4% paraformaldehyde, and then embedded in paraffin, and cut into 15 μm thick coronal slices. The sections with the largest tumor area were stained with hematoxylin and eosin or were used for IHC staining. For the IHC analysis, we quantitatively scored the tissue sections according to the percentage of positive cells and staining intensity. We assigned the following proportion scores: 1 if 0–25% of the tumor cells showed positive staining, 2 if 26–50% of cells were stained, 3 if 51–75% stained, and 4 if 76–100% stained; we also divided different expression levels into four different groups (1 to 4) and scored them.