1. Chemicals and Reagents
The antibodies of vascular endothelial growth factor (VEGF) (A8074), focal adhesion kinase (FAK) (A11131), phospho-FAK-Y397 (p-FAK) (AP0302), P38 (A14401), phospho-P38 (AP0055), Collagen I (COL I) (A16891) and cellular (c)-Myc (A1309) were obtained by Abclonal Inc.(China). The antibody of P300 (sc-48343) was obtained by Santa Cruz Inc.(USA). SiRNA for c-Myc and P300 were purchased from Sigma(USA). FAK inhibitors (PF-573228), antagonist for integrin αVβ3 (HY-100563) and integrin α5β1 (HY-13535A) were obtained by MCE Inc.(USA). DMEM/F12 (1:1), PBS and fetal bovine serum were provided by Gibco (St. Louis, Missouri, USA).
2. Isolation and Culture of Human WJ-MSCs
Human WJ-MSCs were isolated as previously described [17]. Briefly, MSCs were isolated from collected human umbilical cords within 2 h. Removing the umbilical arteries and umbilical vein, Wharton’s jelly was peeled off from the remaining part of the umbilical cords and transferred to a sterile container and then cut into pieces smaller than 0.5 cm3. The minced Wharton’s jelly was digested for 4 h in a 50-ml sterile centrifuge tube with 30-ml culture medium containing collagenase of type I (Invitrogen, Thermo Fisher Scientific Inc., USA) at 0.2% in an incubator (5% carbon dioxide, 37 °C). After centrifuging the liquid at 300×g for 15 min and discarding the supernatants, the cells were resuspended in DMEM/F12 medium with 10% fetal bovine serum and 1% penicillin-streptomycin (Gibco BRL, Thermo Fisher Scientific Inc., USA) in humidified air with 5% carbon dioxide at 37 °C. The WJ-MSCs were passaged once the flask reached approximately 80% confluence and the fourth passage was used for the next experiments.
3. Preparation of ECM
The ECM derived from WJ-MSCs was prepared as previously described [18]. Briefly, plastic flasks (Plastic) were precoated with 0.2% gelatin (Sigma-Aldrich, St. Louis, MO) at 37 °C for 1 h and seeded with passage WJ-MSCs at 6,000 cells per cm2. After reaching 90% confluence, cells were cultured for another 10 days with 250 μM L-ascorbic acid phosphate (Wako Chemicals USA, Inc., Richmond, VA). The cells were lysed with 0.5% Triton X-100 containing 20 mM ammonium hydroxide at 37 °C for 5 min and then stored at 4 °C in PBS containing 100 U/mL penicillin, 100 μg/mL streptomycin, and 0.25 μg/mL fungizone until use.
4. Culture and Treatment for HUVECs
HUVECs were purchased from American type cultures (Rockville, MD, USA) and supplemented with 10% fetal bovine serum in DMEM medium. For the co-culturing of HUVECs and WJ-MSCs ECM, the culture plates were precoated with WJ-MSCs ECM before seeding HUVECs. The HUVECs were co-cultured with WJ-MSCs ECM for 2d, 7d, and 14d, respectively. As to the expression silence of genes, HUVECs were transfected with SiRNA, and Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) was used at 50 nM in the final episode.
5. Assays for Detecting the Angiogenesis Ability of HUVECs
In the transwell cell migration experiment, 1.0 × 105 HUVECs were inoculated in the upper chamber of the 12-well transwell culture plate (Corning, NY, U.S.A.) with an aperture of 8 μm. After 24 h culture, the upper cells were removed and stained with 20% methanol and 0.2% crystal violet. The cells are then imaged under an optical microscope (Olympus), with 10 separate field counts inserted. The results were the average of the three independent experiments. For the tube formation, the treated HUVECs (1 × 104/well) were seeded into Matrigel-coated wells in a 96-well plate. The cells were seeded in serum-free media for 8 h. Only a tube that was completely continuous between two branching points was considered a tube.
6. RNA Isolation and RT-qPCR
Total RNA was isolated using TRIzol® reagent. Simply placed HUVECs in a 1.5 mL homogenizer, and added 1 ml TRIzol to fully homogenate, and let stand at room temperature for 5 min. After adding 0.2 ml chloroform, the homogenizer was centrifuged for 15 seconds, and left standing for 2 min. After centrifugation at 4 ℃ for 12000 g×15 min, the supernatant was placed in another 1.5 mL centrifuge tube. 0.5 ml isopropyl alcohol was added to the centrifuge tube, and the centrifuge tube was left standing at room temperature for 10 min after gently stirring. After centrifugation at 4 ℃ for 12000 g×10 min, the supernatant was discarded. Using 1ML 75% ethanol, wash the precipitate gently. After centrifugation at 4 ℃ for 7500 g×5 min, the supernatant was discarded. After drying, DEPC H2O was added to dissolve (65 ℃, ~10-15 min). 1 μg RNA was transcribed into cDNA. RT-qPCR was performed on an A.B.I. Step One RT-qPCR hot circulator (A.B.I. Step One, New York, USA) using the SYBR®Premix Ex Taq™ kit. The RT-qPCR products isolated from the DNA extraction kit were diluted in multiples to construct the relative standard curve of the target gene. The results were expressed as fold values relative to the control group. The rat primer sequences of the genes used in this study were shown in Table 1.
7. Chromatin Immunoprecipitation (ChIP) Assay
Cells in Alginate beads were cross-linked with 1% formaldehyde before sonicating in SDS lysis buffer. DNA in cell lysates was sheared to length of approximately 200 base pairs. Fragmented chromatin was first pre-cleared with protein A-sepharose 4B and rabbit IgG for 2 h. Before immunoprecipitating with fresh protein A-sepharose 4B and antibody include anti-histone 3 lysine 9 acetylation (H3K9ac), anti-H3K14ac and anti-H3K27ac (Abcam, USA) at 4 °C overnight. Sepharose beads were washed before eluting with 1% SDS followed by reverse cross-linking at 65 °C overnight. The samples were then placed in a 65 °C water bath overnight to reverse formaldehyde cross-linking and subsequently were purified using PCR purification kits. The isolated DNA was then assayed using RT-qPCR. The primer sequences of the promoters were as follows: forward, TACTTCCCCAAATCACTGTGG, reverse, CTCTGGAGCTCTTGCTACCTC. The input values were compared to the immunoprecipitated samples, with the IgG negative controls values subtracted as background. The calculated errors in all of the graphs depicting ChIP data represent the standard deviations for three replicate RT-qPCRs for precipitated chromatin, input chromatin, and background (i.e., chromatin precipitated with nonspecific IgG).
8. Co-Immunoprecipitation (Co-IP) Assay
A Co-IP assay was performed to detect the interaction of c-Myc with P300. After washing with ice-cold PBS, cells were lysed in 1.2 ml lysis buffer at -80 ℃ for 30 min. The samples were centrifugated with 14,000 rpm at 4 ℃ for 15 min and the supernatant was transferred to a new column. And then, the samples were divided into three parts: the first was used for input protein, the other two were performed using 1 ug of either a mock antibody (IgG) as control or c-Myc antibody respectively followed by incubation overnight at 4 °C with gentle shaking. And then the samples were incubated with protein G magnetic beads (Millipore, 16-157) at 4 °C for 6 h. After immunoprecipitation, the samples were washed with lysis buffer. After three washing pieces, retained proteins were mixed with 30 ul loading buffer at 100 ℃ for 10 min. Protein complexes and input protein were then detected by Western blotting.
9. Immunofluorescence Staining
For the immunofluorescence, cells were washed with PBS and fixed with 4% paraformaldehyde for 15 min. Cells were washed and permeated with 0.5% Triton X-100 in PBS for 20 min at room temperature, and then, the cells were blocked with 5% BSA in PBS for 1 h. Antibodies was added and incubated overnight at 4 °C. Fluorescent secondary antibody (1:100, Bioss Inc., Beijing, China) was added for 2 h at room temperature. Cells were then incubated with DAPI for 5 min at room temperature. Five sections of each slice were taken and photographed. The mean optical density (MOD) of immunohistochemistry was quantified by two individuals under the double-blind principle.
10. Western Blotting
About 0.04 mg protein was separated by 10% SDS-PAGE gel and adsorbed into the nitrocellulose membrane. The first-antibodies were incubated at 4 ℃ overnight. After incubating with the first-antibodies, the membrane was washed with TBST three times. Then, the membrane was incubated with a horseradish peroxidase-labeled secondary antibody (1:5000) at room temperature for 1 h. The signal was detected with ECL reagent.
11. Statistical Analysis
In this study, Prism 8.0 was used for data analysis. Quantitative data were expressed as mean ± S.E.M. Multiple comparisons were performed using one-way analysis of variance (ANOVA). The unpaired two-tailed student’s t-test was used for comparison between the control group and the other single groups. P<0.05 was considered statistically significant.