Study subjects and collection of blood samples
A total of 30 sepsis-associated ARDS patients and 30 normal controls (≥ 18 years) hospitalized in Jianhu Hospital Affiliated to Nantong University were recruited. Patients with ARDS during sepsis were also included in accordance with the ACCP/SCCM Consensus (“Sepsis-2”) Criteria (16). Main clinicopathological characteristics of the participants are summarized in Table 1. All corresponding blood samples were collected according to the protocol approved by the Ethics Committee at Jianhu Hospital Affiliated to Nantong University and written informed consents were obtained from all participants.
Animals
All animal care and experiment procedures were conducted in accordance with the guidelines approved by the Animal Ethical Committee of Jianhu Hospital Affiliated to Nantong University. Eight-week-old wild-type (WT) mice (C57BL/6 background) were obtained from Oriental Bio Service Inc. (Nanjing) and housed in a room on a 12 h light/dark cycle at 22 °C ± 2 °C with 55–65% relative humidity and fed on a standard chow diet ad libitum.
Mice model of polymicrobial sepsis
Mice were anesthetized with 10% chloral hydrate and underwent cecal ligation and puncture (CLP) as described previously with minor modification (17). Briefly, incision (2–3 cm) was made in the midline abdominal wall to expose the cecum. Subsequently, the cecum was ligated one centimeter from the tip with 4 − 0 silk suture. A 21-gauge needle was used for one puncture site where a small amount of fecal contents were squeezed. Finally, the incision was sutured with 4 − 0 silk suture. The sham-operated mice were defined as normal, with only laparotomy performed. After CLP procedures, mice were resuscitated with 1 ml of pre-warmed saline through subcutaneously injection.
Hematoxylin and Eosin (H&E) Staining
Lung tissues were placed in 4% paraformaldehyde for 24 h, dehydrated for another 12 h, paraffn-embedded, and sliced at 5 µm thickness. Then, the lung tissue sections were dewaxed with xylene and rehydrated with gradient ethanol. Sequentially, hematoxylin and eosin were used to stain the slides. Finally, the sections were sealed with gum and observed under a light microscope (Nikon Eclipse Ti; Nikon Corporation, Tokyo, Japan) at the 200 × magnification to capture the pathological changes including hyperemia, alveolar congestion, presence of exudates, etc.
Enzyme-Linked Immunosorbent Assay (ELISA)
The amount of pro-inflammatory cytokines such as S100A12, sRAGE, TNF-a,IL-1β and IL-6 in serum, bronchoalveolar lavage fluid (BALF) and NHBE cells supernatants of each group was detected by enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN, USA) following the manufacturer’s instructions. The optical density (OD) value at 450–650 nm was measured by a microplate reader. Western blot analysis
Homogenized mice lung tissues and NHBE cells were lysed with IPA lysis buffer supplemented with 1 mmol/L PMSF and other protease inhibitors to abtain samples. Protein samples (25 µg) were fractionated by 10% SDS-PAGE gels and then transferred onto PVDF membranes. After blocked with 5% skim milk, the membranes were incubated with primary antibodies against S100A12 (1 : 1,000), sRAGE (1 : 1,000), SDF-1(1 : 1,000), CXCR4 (1 : 1,000), ICAM-1 (1 : 1,000),VCAM-1(1 : 1,000), MCP-1 (1 : 1,000), bcl2 (1 : 1,000), bax (1 : 1,000), cleaved caspase (1 : 500), caspase3 (1 : 500), NLRP3 (1:1000), ASC (1:1000), caspase1 (1:1000), and GAPDH (1 : 2,000) overnight at 4 °C, then the membranes were washed with PBS and incubated with appropriate HRP-conjugated secondary antibody at room temperature for 2 h. The protein bands were measured with chemiluminescence reagent (Thermo Fisher Scientifc, Inc.). Finally, we determined the relative intensity for target proteins via dividing the absolute intensity of target proteins by the absolute intensity of GAPDH.
Immunohistochemistry (IHC) staining
All paraffin sections were immersed in 3% H2O2 in PBS for 10–15 min to block endogenous peroxidase activity, after deparaffinization and rehydration. Subsequently, sections were incubated with 5% Bovine Serum Albumin (BSA) at room temperature for 40 min to block non-specific binding. For immunostaining, anti-S100A12 monoclonal antibody (1:100) and anti-sRAGE monoclonal antibody (1:100) were applied at 4 °C overnight, which were purchased from Millipore (Billerica, MA). After PBS washing, the sections were incubated with biotin-conjugated secondary antibody (1:100) at room temperature for 2 h and then were visualized with DAB. The spread and intensity of S100A12 and sRAGE positive immunoreactivity of each group were observed and captured under a light microscope at the 200 × magnification (Nikon Eclipse Ti; Nikon Corporation, Tokyo, Japan).
TUNEL Assay
The apoptotic cells in lung tissue were detected via TUNEL assay. The TUNEL assay kit (Merck Millipore, Darmstadt, Germany) was employed to determine the presence of apoptotic cells following the manufacturer’s protocol. The lung tissue sections were stained with TUNEL reagents and observed under an optical microscope (Olympus Corp., Tokyo, Japan) at 200 × magnification to count the positive cells.
Cell culture
The normal human bronchial epithelial (NHBE) cell line was obtained from American Type Culture Collection (Manassas, VA, USA) and was cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS, Thermo Fisher Scientific, U.S.A.), 100 µg/mL streptomycin and 100 units/mL penicillin (Invitrogen, Carlsbad, CA, USA) at 37 °C in a 5% CO2 humidified atmosphere. The cells were stimulated with Recombinant human S100A12 (50, 100, 200, 500 ng/ml), purchased from MBL (Aichi, Japan), before use in subsequent experiments.
RNA extraction and Reverse-transcriptase quantitative real-time PCR (RT-qPCR)
Total RNA was prepared from NHBE cells with Trizol reagent (Ambion, USA) according to the manufacturer’s recommendations. The cDNAs were synthesized by reverse transcription of 1 µg total RNAs using PrimeScript RT Master Mix Kit (TaKaRa, Otsu, Shiga, Japan). Subsequently, qPCR assay was employed to detect the target gene expression of each word with equal amount of cDNA using SYBR® Green Master Mix (Applied Biosystems, Foster City, CA, USA). Gene expression levels were carried out using the 2−ΔΔCt method and normalized to the expression of GAPDH. Gene specific primer sequences for qPCR amplification were designed as follows:
MUC5AC | Forward | 5’- CCTGCAAGCCTCCAGGTAG − 3’ |
Reverse | 5’- CTGCTCCACTGGCTTTGG − 3’ |
MUC1 | Forward | 5’- TCCAATATTAAGTTCAGGCCAGGA − 3’ |
Reverse | 5’- CACATCACTCACGCTGACGT − 3’ |
SDF-1 | Forward | 5’- AAAGAAGCGACAGAAGAAGAG − 3’ |
Reverse | 5’- AAGAGGGAGGAGCGAGTT − 3’ |
CXCR4 | Forward | 5’- CTACAGCAGCGTTCTCATC − 3’ |
Reverse | 5’- TTTTCAGCCAGCAGTTTC − 3’ |
ICAM-1 | Forward | 5’- AGACCTATGTCCTGCCATCG − 3’ |
Reverse | 5’- GGTGCCCTCCTCATTTTCCT − 3’ |
VCAM-1 | Forward | 5’- GAACTGGAAGTCTACATCTC − 3’ |
Reverse | 5’- CAGAGAATCCGTGGAGCTGG − 3’ |
MCP-1 | Forward | 5’- CCCTAAGGTCTTCAGCACCT − 3’ |
Reverse | 5’- ACTGTCACATGGTCACTCC − 3’ |
GAPDH | Forward | 5’- GAAGGTGAAGGTCGGAGTCA − 3’ |
Reverse | 5’- GACAAGCTTCCCGTTCTCAG − 3’ |
Flow Cytometry
The Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis detection kit ((Biosea, Beijing, China) was used to analyze cell apoptosis in vitro, following the manufacturer’s protocol. NHBE cells were seeded in 6-well plates and then incubated with or without 100 ng/mL LPS and S100A12 (50, 100, 200, 500 ng/ml) for 24 h. NHBE cells (1 × 106 cells/mL) were collected, washed with cold PBS and re-suspended with 1 × binding buffer. Then, NHBE cells were stained with Annexin 5 µL V-FITC and 10 µL PI staining solution. The Annexin V-FITC-positive and PI-negative cells were defined as apoptotic cells, and the percentage of apoptotic cells in each group was conducted and analyzed using a flow cytometer (Beckman, Coulter, USA).
Analyses for Total Antioxidant Capacity, ROS, MDA, and Antioxidant Enzymes
Total antioxidant capacity of cell lysates was analyzed. The amount of reactive oxygen species (ROS) and malondialdehyde (MDA), and antioxidant enzymes activities, such as superoxide dismutase (SOD), lactate dehydrogenase (LDH), glutathione peroxidase (GSH-Px), were detected using the specific commercial assay kits, according to the manufacturer's recommendations. Subsequently, absorbance was measured by a microplate reader (Thermo Fisher Scientific, USA)
Statistical Analysis
All experimental data are expressed as the mean ± standard deviation (SD) and statistically analyzed with SPSS 17.0 software. Students’ t-tests were used to analyze the parameters among groups, and one-way analysis of variance (ANOVA) test followed by Bonferroni’s post hoc test was performed to analyze the statistical difference among multi-groups. P-value < 0.05 was considered to indicate the statistical significance.