Clinical specimens
Human OA articular cartilage specimens were obtained from the femoral condyles and tibial plateaus of patients undergoing total knee arthroplasty while normal articular cartilage samples were obtained from patients with irreparable articular cartilage injury at the First Affiliated Hospital of Harbin Medical University, Harbin, People’s Republic of China. The research was approved by the Ethics Committee of the First Affiliated Hospital of Harbin Medical University and was performed in accordance with the Declaration of Helsinki. Written informed consent was obtained from all patients and their family members.
Chondrocyte culture
Chondrocytes were extracted from cartilage by enzymatic digestion, as described previously [30]. Small pieces of cartilage were digested in 0.25% protease (Gibco, USA) for 30 min and then with 2mg/ml collagenase (Sigma) for 24h at 37℃. Cells were seeded at a density of 1×105 cells/cm2 then cultured in Dulbecco’s Modified Eagle Medium (DMEM; Hyclone) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, USA) and antibiotics (100 μg/mL streptomycin and 100 U/mL penicillin; Beyotime, People’s Republic of China) at 37°C in a humidified atmosphere of 5% CO2. Only first and second-passage cells were used to ensure a stable phenotype.
Cell Viability Assay
A Cell Counting Kit-8 (CCK8) (Dojindo, Japan) assay was used to determine cell viability following treatment with ATX inhibitor at a variety of concentrations, as described previously, with minor modifications. Chondrocytes (1 × 104 /well) were incubated in a 96-well plate for 24h. After appropriate treatment at different drug concentrations, chondrocytes were incubated with CCK-8 solution in accordance with the manufacturer’s instructions for 1h at 37℃. The quantity of dye formation was measured at 450nm.
Quantitative Real-time Polymerase Chain Reaction (qRT-PCR)
Chondrocytes were treated with ATX inhibitor (10μM, Sigma, USA) for 24h or 48h prior to total RNA extraction using TRIzol reagent (Life Technologies, USA) and then reverse transcription into cDNA (Toyobo, Japan). qRT-PCR amplification was measured using SYBR Green, in accordance with standard Bio-rad protocols. The sequences of primers used in the present study are shown in Table 1.
Table 1. Sequences of Primers.
Target gene
|
Forward primer (5’–3’)
|
Reverse primer (5’–3’)
|
col2a1
|
CATGGAGACTGGCGAGACTTG
|
GTGGACAGCAGGCGTAGGAA
|
mmp13
|
CGTATTGTTCGCGTCATGCC
|
GTTCCAGCCACGCATAGTCAT
|
adamts-5
|
GTGGTGGTGCTAGGCGACAA
|
CCACATAAATCCTCCCGAGTAAACA
|
lc3
|
CTTCTGAGCCAGCAGTAGGG
|
GGCAGAGTAGGTGGGTTGGT
|
p62
|
ACATAGCTTGCCTAATGGCTTTCAC
|
CCTGCCTGCTGACAACACCTA
|
mTOR
|
GGCCTGGATGGCAACTACAGA
|
TGACTGGCCAGCAGAGTAGGAA
|
lamp1
|
GTTTCTTCATTCTTTACTG
|
TCTCTACTGTTGTAATGT
|
β-actin
|
AGCCTCGCCTTTGCCGA
|
CTGGTGCCTGGGGCG
|
Western blotting (WB)
Chondrocytes were lysed in cold RIPA lysis buffer and intracellular proteins separated using 12.5% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) prior to transfer to polyvinylidene difluoride membranes, as described previously [31]. Subsequently, the membranes were blocked with 5% non-fat milk and incubated with primary antibodies overnight against the following antigens: mTOR (1:1000; Cell Signaling Technology, USA), P62 (1:1000; Abcam, UK), LC3 (1:1000; Cell Signaling Technology, USA), ADAMTS-5 (1:1000; Abcam, UK), MMP-13 (1:1000; Cell Signaling Technology, USA), COL2A1 (1:1000; Abcam, UK), and LAMP1 (1:250, Abcam; UK). They were then incubated with a secondary antibody (1:15,000; LICOR, USA) for 45 min at 37℃ and washed three times with tris-buffered saline with Tween 20 (TBST). Target bands were visualized using a LICOR Odyssey chemiluminometer and analyzed using ImageJ software (National Institutes of Health, USA).
Immunofluorescence assay
Primary chondrocytes were seeded on sterile glass coverslips in 24-well plates, fixed using 4% paraformaldehyde at 4℃ for 20 min, then permeabilized with 0.3% Triton X-100 for 10 min prior to blocking nonspecific binding with goat serum (Boster, People’s Republic of China) for 1 hour at room temperature. The chondrocytes were then incubated with primary antibodies (20 μg/mL final concentration; Abcam, UK) overnight at 4°C and then stained with fluorophore-conjugated secondary antibodies (Abcam, UK) for 30 min at 37℃. The nuclei were stained with DAPI after washing with PBS.
LysoTracker Labeling and FACS Analysis
Intracellular lysosomes were stained with LysoTracker Green (1:20,000; Cell Signaling Technology, USA) for 30 min at 37°C in the dark and then washed. The proportion of LysoTracker-positive cells was measured by flow cytometry.
Autophagic flux analysis
Chondrocytes were transfected with HBAD-mcherry-EGFP-LC3 adenovirus (Hanbio, China) in confocal plates. After 24 hours, the chondrocytes were stimulated for the subsequent 24h or 48h using ATX inhibitor. After treatment, yellow and red puncta were detected using a confocal microscope (Nikon, Japan).
Statistical analysis
Analyses were performed using GraphPad Prism Version 5.0 (GraphPad Software, Inc., La Jolla, CA, USA) or SPSS Statistics Version 19 (IBM Corporation, Armonk, NY, USA). All collected data are represented as means ± standard error of the mean (SEM) and analyzed using a Student’s t-test or by analysis of variance (ANOVA). Values of p<0.05 were considered statistically significant.