Long Non-Coding RNA MPNCR is a Negative Regulator of Bovine Mammary Epithelial Cell Proliferation

doi:10.21203/rs.3.rs-112918/v1

Download PDF

Research

Long Non-Coding RNA MPNCR is a Negative Regulator of Bovine Mammary Epithelial Cell Proliferation

https://doi.org/10.21203/rs.3.rs-112918/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Numerous studies have reported that many long non-coding RNAs (lncRNAs) may play multiple essential roles during mammary gland development; however, little is known about their functions and regulatory mechanism.

Results

In this study, we confirmed a novel lncRNA, MPNCR, that was highly expressed during lactation compared to the dry period in dairy cattle. The potential biological and regulatory functions of MPNCR were explored in bovine mammary epithelial cells (BMECs). The MTT and EdU assays revealed that lncRNA MPNCR significantly suppressed cell viability and proliferation of BMECs. The subcellular localization indicated that MPNCR had a potential function as a competing endogenous RNA (ceRNA) to regulate the proliferation of BMECs. Bioinformatics analysis showed that lncRNA MPNCR had two binding sites for miR-31, further confirmed by the dual-luciferase report assay. The RT-qPCR result showed that the expression of miR-31 was downregulated following the overexpression of MPNCR in BMECs. Furthermore, the expression of MPNCR was significantly inhibited by miR-31 overexpression and upregulated by miR-31 inhibition. Cell viability and proliferation were significantly suppressed or promoted with the transfection of miR-31 inhibitor or miR-31 mimic into BMECs, respectively, whereas rescue with MPNCR reduced the proliferation of BMECs. The dual-luciferase report assay showed an interaction between miR-31 and the 3' UTR of the target gene CAMK2D. RT-qPCR and western blot further showed that the expression of CAMK2D was significantly increased with the overexpression of miR-31, while its expression was significantly suppressed with the inhibition of miR-31, indicating CAMK2D was a target of miR-31.

Conclusion

Taken together, these results demonstrate the function and regulatory mechanism of lncRNA MPNCR on the proliferation of BMECs, and that its regulation may contribute to bovine mammary cell population management.

Animal Science

lncRNA MPNCR

miR-31

CAMK2D

bovine mammary epithelial cell

cell proliferation

The development of the mammary gland undergoes periodic changes during adult life, such as growth and degeneration associated with mammary epithelial cell proliferation, differentiation, and apoptosis due to the change of age, reproductive stage, and lactation status [1–3]. In mammary gland tissue, only mature mammary epithelial cells can synthesize and secrete milk proteins, and the number of cells and secretion ability of each cell determine the milking capacity of dairy cow [4, 5]. Mammary epithelial cells maintain lactation by increasing proliferation and reducing apoptosis, which retains a dynamic equilibrium during a lactation cycle in the mammary gland [6].

Increasing evidence suggests that long non-coding RNAs (lncRNAs) play essential roles in mammary gland development and breast cancer biology [7, 8]. LncRNAs are defined as transcribed RNAs with the length of more than 200 nucleotides that lack an open reading frame and have limited protein-coding capacity; they can modulate numerous processes at the epigenetic, transcriptional, and post-transcriptional levels [9, 10]. LncRNAs play crucial roles in cell proliferation, differentiation, apoptosis, and invasion [11–13]. To date, various mechanisms have been proposed to illustrate how lncRNAs regulate gene expression. The best-characterized mechanism is lncRNAs mediating gene expression by acting as scaffolds [14], decoys [15], and signaling molecules [16]. The lncRNA AK023948 is a positive regulator for AKT in breast cancer, operating through a functional interaction with DHX9 and p85 [8]. Mouse pregnancy-induced non-coding RNA (mPINC) and Zfas1 (Znfx1 antisense 1) suppress the growth of mammary epithelial cells [17, 18]. LncRNA-HAL, which is a nuclear lncRNA, inhibits the proliferation of mammary epithelial cells at the chromatin level and through transcriptional regulation by binding to histones and hnRNPs, respectively [19]. The intergenic lncRNA EPR (epithelial cell program regulator) inhibits mammary epithelial cell proliferation by modulating gene expression in response to TGF-β [20].

One of the regulatory mechanisms of lncRNA is acting as competing endogenous RNAs (ceRNAs) by binding miRNA to modulate the expression of the sponged miRNA target [21–23]. For example, lncRNA TTN-AS1 regulates the expression of ZEB1 through competing with miR-139-5p to enhance the proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) of breast cancer cells [24]. Long non-coding RNA XIST promotes chemoresistance of breast cancer cells to doxorubicin by sponging miR-200c-3p to upregulate the expression of ANLN, which is a downstream target gene of miR-200c-3p [25]. LncRNA-PNUTS serves as a competitive sponge for miR-205 during EMT, and its expression correlates with ZEB mRNA level [26].

Numerous studies have identified many differentially expressed lncRNAs in different types or phases of bovine mammary gland tissues, reflecting their potential roles in bovine mammary inflammation, immune response, and lactation based on bioinformatics and integrative analysis [27–31]. However, relatively few lncRNA has been explored for their functions in the mammary gland.

The lncRNA MPNCR (mammary proliferation-associated long non-coding RNA) has been reported to be highly expressed in the lactation period compared to the dry period of Chinese Holstein mammary tissues, and the bioinformatics analysis implied that MPNCR had a potential ceRNA regulatory mechanism in lactation [32]. Given the critical role of MPNCR in bovine lactation, we aimed to investigate its function and molecular mechanism using the bovine mammary epithelial cells (BMEC) model, which could help decipher the regulatory machinery of lactation and contribute to further improvement in milk yield in dairy cattle.

RNA isolation and RT-qPCR

Mammary gland biopsies were harvested from eight healthy Chinese Holstein dairy cows as described by Yang et al [32]. Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA USA) according to the instructions and quantified by a NanoDrop 2000c Spectrophotometer (Thermo, Waltham, MA, USA). Then, 1 µg RNA was reverse-transcribed into cDNA using a PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa, Dalian, China). MiR-31 was reverse-transcribed through a specific stem-loop RT primer using the PrimerScript RT reagent kit. RT-qPCR was performed using a Bio-Rad CFX96 Touch Real-time PCR detection system (BioRad, Hercules, CA, USA), and the relative abundance of the mRNAs was determined using SYBR Premix Ex Taq II (TaKaRa, Dalian, China) according to the manufacturer's instructions. The following thermal settings were used for lncRNA and coding gene: 95 °C for 3 min, followed by 40 cycles of 95 °C for 15 s and 54 °C for 30 s. The RT-qPCR conditions for miR-31 were as follows: 95 °C for 3 min, followed by 40 cycles of 95 °C for 12 s and 60 °C for 34 s. The primers used for RT-qPCR are listed in Table 1.

Table 1

Real-time quantitative PCR primer information
gene	Sequence (5' ~3'; F: forward, R: reverse)	Product size (bp)
lncRNA MPNCR	F: tattgagtgactttcatcgta	192
lncRNA MPNCR	R: tagagtttgagatttcttgga	192
CAMK2D	F: cattgacacctaaatggcatag	125
CAMK2D	R: tctccttggacttctatggc	125
GAPDH	F: agatggtgaaggtcggagtg	189
GAPDH	R: cgttctctgccttgactgtg	189
miR-31 RT-primer	ctcaactggtgtcgtggagtcggcaattcagttgagagctat
U6	F: ctcgcttcggcagcaca	94
U6	R: aacgcttcacgaatttgcgt	94
miR-31	F: tgcccgaggcaagatgctgg	57
miR-31	R: gtgtcgtggagtcggcaa	57

Plasmid construction

The pcDNA3.1(+) vector (Invitrogen, Carlsbad, CA, USA) was used to construct lncRNA MPNCR overexpression plasmid to explore its function in BMECs. The full-length complementary sequence of MPNCR was amplified by PCR from the BMECs genome. Then, the PCR product was digested with XhoI and BamHI restriction enzymes and cloned into the pcDNA3.1(+) vector. The constructed overexpression vector was named pcDNA3.1(+)-MPNCR. The potential binding sites between MPNCR and miR-31 were predicted by RNAhybrid (https://bibiserv.cebitec.uni-bielefeld.de/rnahybrid/). The potential target genes MAPK6, MAPK14, and CAMK2D of miR-31 were predicted by miRBase (http://www.mirbase.org/) and TargetScan (http://www.targetscan.org/vert_71/). The target sequences of lncRNA MPNCR and the 3′-UTRs of MAPK6, MAPK14, and CAMK2D containing the wild binding sites of miR-31 were amplified by PCR, and the 3′-UTRs of these three genes containing the mutant binding sites of miR-31 were obtained by overlap PCR. Then, the PCR products were cloned into the downstream of the Renilla gene of the psiCHECK-2 vector (Promega, Madison, WI, USA), which was digested by the restriction enzymes XholI and NotI (NEB, New England) for the dual-luciferase assay. The PCR products' sizes and overlap primer information are listed in Table 2. The miR-31 mimic, mimic-NC, inhibitor, and inhibitor-NC were synthesized by GenePharma Co., Ltd. (Shanghai, China).

Table 2

Vector construction primer information
gene	Sequence (5' ~3'; F: forward, R: reverse)	Product size (bp)
lncRNA MPNCR	F: CGggatcctcacatattgctgaagcctggc	1176
lncRNA MPNCR	R: CCGctcgagctggaaacctcacacgcagc	1176
lncRNA MPNCR-3’UTR	F: CCGctcgaggtcagtcagtcatctgactc	569
lncRNA MPNCR-3’UTR	R: ATTTgcggccgcgcttcctgtaaaagggcag	569
MAPK6-3'UTR	F1: CCGctcgagctggcatgtcgtttgcac	396
	R1: ctcactgtgtaaatttcatccgttcttttttgtttcctgtaaaac
	F2: gttttacaggaaacaaaaaagaacggatgaaatttacacagtgag
	R2: ATTTgcggccgccgctggctaaatagaagtgc
MAPK14-3'UTR	F1: CCGctcgaggaccttccgggtagttcagaac	300
	R1: agtttgttgaaaaccagatccgttctatggaaatgctatacatcc
	F2: ggatgtatagcatttccatagaacggatctggttttcaacaaact
	R2: ATTTgcggccgcagcattggttactgggagtgaag
CAMK2D-3'UTR	F1: CCGctcgagcactttaagcatgtggtgt	252
	R1: atcagtcatttaccattatccgttctaatatatacagtgtcccatg
	F2: catgggacactgtatatattagaacggataatggtaaatgactgat
	R2: ATTTgcggccgctcagcagaaatcacaaatttat
Note: The nucleotides in bold and underline indicate the restriction enzyme sites. "ATTT", "CG" and "CCG" represent the protective nucleotides. The nucleotides in italic and bold represent the mutant binding sites of miR-31.

Cell culture and transfection

The bovine mammary epithelial cell line was used to explore the function and regulatory mechanism of lncRNA and miRNA. It was obtained from the primary bovine mammary alveolar cells by stable transfection with SV-40 T antigen [33] and cultured in a 1:1 mixture of Ham's F-12 and Dulbecco's modified eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin according to Jiao et al [34]. LncRNA MPNCR overexpression plasmid vector, miR-31 mimic or inhibitor were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions when the cells were at 60–80% confluence.

The luciferase assay was used to test possible interactions of miR-31 with its target genes and with lncRNA MPNCR using HEK293T cell transfections. HEK293T cells were cultured in DMEM and supplemented with 10% FBS and 100 U/mL penicillin-streptomycin at 37 °C with 5% CO₂, and 600 ng/mL wild (or mutant) dual-luciferase reporter vector. Then, and 20 nM miR-31 mimic (or mimic-NC) per well were co-transfected into HEK293T cells using Lipofectamine 2000. The transfected HEK293T cells were lysed with passive lysis buffer, and the cell lysate (10 µL) was added into a 96-well enzyme label plate. Then, the optical density (OD) was measured using a 30 µL luciferase assay reagent on a M200 Pro (Tecan, Mannedorf, Switzerland). The data were presented as normalized relative luciferase activity (Renilla/Firefly, OD/OD). Each experiment was performed in triplicate.

MTT assay and EdU staining

To assess the effect of MPNCR on BMEC proliferation, the (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium (MTT) and 5-Ethynyl-2'-deoxyuridine (EdU) assays were performed. The bovine mammary epithelial cells were seeded in a 96-well plate. When the confluence reached 1 × 10⁴ cells per well, 100 ng pcDNA3.1(+)-MPNCR vector, 20 nM miR-31 mimic (and mimic-NC) or 40 nM miR-31 inhibitor (and inhibitor-NC) per well were transfected into BMECs by lipofectamine 2000 according to the manufacturer's protocol with six replicates. The MTT treatment and absorbance measurements were performed, as described in Zhang et al [35].

EdU staining was performed when BMECs reached a confluence of 1 × 10⁴ cells per well in 96-well plates with three replicates per condition. PcDNA3.1(+)-MPNCR (100 ng per well), miR-31 mimic (20 nM), or miR-31 inhibitor (40 nM) were transfected into BMECs. After 36 h, cells were stained with 50 µM Edu (Ribobio, Guangzhou, China) for 2 h according to the manufacturer's protocol. The cells were visualized under a fluorescence microscope with 50 µm scale. The ratio of EdU positive cells was calculated according to the formula (EdU staining cells/the total of cells) × 100%.

Nuclear and cytoplasmic RNA fraction

To determine the location of MPNCR in BMECs, a PARIS kit (Life Technologies, Shanghai, China) was used to extract nuclear and cytoplasmic RNA according to the manufacturer's instruction. The RNA was then transcribed into complementary DNA, and the location of MPNCR was analyzed by the PCR method.

Western blot analysis

To detect the effects of MPNCR and miR-31 on their target genes at the protein level, a Western blot assay was performed. The total protein was extracted from BMECs transfected with the overexpression vector pcDNA3.1(+)-MPNCR (or pcDNA3.1(+)) (600 ng/mL), miR-31 mimic (or mimic-NC) or miR-31 inhibitor (or inhibitor-NC) (20 nM) for 72 h, using radioimmunoprecipitation assay (RIPA) cell lysis solution (Applygen, Beijing, China). The proteins were separated by 12% SDS-polyacrylamide gel electrophoresis and then transferred onto a poly (vinylidene difluoride) (PVDF) membrane (Millipore Corporation, MA, USA). Then, the membranes were sealed with 5% skimmed milk solution for 1 h at room temperature and incubated at 4 °C for 12 h with the primary antibody against CAMK2D (Abcam, Cambridge, UK). Then the PVDF membrane was incubated with an HRP conjugated secondary antibody goat-anti-rabbit IgG (Zhongshan-Bio, Beijing, China) for 2 h. After washing three times with PBS, the protein bands were observed with a Super ECL Plus detection kit (Applygen, Beijing, China) using a Mini Chemiluminescent Imaging and Analysis System (Beijing Sage Creation Science Co., Beijing, China). Densitometry analysis was performed using Sage Capture software (Beijing Sage Creation Science Co.) using GAPDH (Abcam) as a control.

LncRNA MPNCR inhibits BMECs proliferation

Figure 1a shows that the expression of lncRNA MPNCR has an over eightfold difference in the lactation period compared to that in the dry period (P < 0.001) using RT-qPCR. This result confirms our previous observations of the transcriptome sequencing analysis [32].

To determine the role of lncRNA MPNCR in mammary epithelial proliferation, the overexpression vector of MPNCR was transfected into BMECs. The RT-qPCR results of MPNCR showed over 20 fold difference in expression in cells transfected with pcDNA3.1(+)-MPNCR compared to the control group transfected with the pcDNA3.1(+) vector (P < 0.001) (Fig. 1b). Following the overexpression of MPNCR, the MTT and EdU assays were performed. The MTT result showed that the overexpression of MPNCR inhibited the cell viability of BMECs compared with the control group (P < 0.001) (Fig. 1c). EdU staining showed that the number of EdU positive staining cells was significantly decreased in the MPNCR overexpression group compared to the control group (P < 0.01) (Figs. 1d and 1e). Taken together, these results demonstrated that lncRNA MPNCR inhibited the proliferation of BMECs.

LncRNA MPNCR acts as a molecular sponge for miR-31

LncRNA can act as a ceRNA by sponging miRNA to reduce the regulatory effect of miRNA on its target [22, 25]. To explore the regulatory mechanisms by which lncRNA MPNCR affects the proliferation of BMECs, we determined its subcellular localization using the PCR method. The result showed that lncRNA MPNCR was localized to the cytoplasm and nucleus (Fig. 2a). Bioinformatics analysis revealed two seed region binding sites between MPNCR and miR-31 (Fig. 2b). To examine possible interactions between MPNCR and miR-31, the dual-luciferase reporter assay was performed. The result revealed that overexpression of miR-31 could significantly reduce the relative luciferase activity of MPNCR compared with the control group (P < 0.05) (Fig. 2c), indicating an interaction between MPNCR and miR-31. Then, the expression level of miR-31 was measured after transfecting vectors pcDNA3.1(+)-MPNCR and pcDNA3.1(+)into BMECs. The RT-qPCR result showed an over two-fold downregulation in the expression of miR-31 with the overexpression of MPNCR (P < 0.001) (Fig. 2d). To identify the optimal overexpression or inhibition effects, different concentrations of miR-31 mimic and inhibitor were transfected into BMECs, respectively. The RT-qPCR results showed that a 20 nM of miR-31 mimic could dramatically increase the expression of miR-31 more than 20 times (P < 0.001), and a 40 nM miR-31 inhibitor could significantly suppress its expression about 10 times (P < 0.001) (Fig. 2e). LncRNA MPNCR was significantly downregulated when miR-31 was overexpressed (P < 0.01), and its expression was upregulated when miR-31 was inhibited compared to their control groups (P < 0.05) (Fig. 2f). These data demonstrated that MPNCR contained the functional binding sites of miR-31.

To further investigate the function of miR-31 in BMEC proliferation, MTT and EdU assays were performed after transfecting miR-31 mimic, inhibitor and their controls into BMECs. The MTT results showed that BMEC viability was significantly increased with the overexpression of miR-31 compared with the mimic-NC group (P < 0.01) (Fig. 2g). Cell viability was dramatically decreased with the inhibition of miR-31 (P < 0.05) compared with its control (Fig. 2g). EdU assay showed that the EdU positive staining cell number was significantly higher with the overexpression of miR-31(Fig. 2h), indicating that the proliferation of BMECs was increased, while the result was reversed with the suppression of miR-31. The result of the EdU assay was consistent with that of the MTT assay result (P < 0.01) (Fig. 2i). Thus, it could be deduced that lncRNA MPNCR and miR-31 have converse effects on BMEC proliferation.

CAMK2D is the target of miR-31

To explore how miR-31 regulates BMEC proliferation, the targets of miR-31 were predicted by miRBase (http://www.mibase.org) and TargetScan (http://www.targetscan.org/vert_71). Given their roles in mammary gland development, the MAPK6, MAPK14, and CAMK2D genes were selected as the potential targets of miR-31. The constructed dual-luciferase reporter vectors were co-transfected into HEK293T cells with miR-31 mimic, mimic-NC, miR-31 inhibitor, or inhibitor-NC. The renilla/firefly luciferase ratio showed that only the luciferase activity of the wild type 3' UTR of CAMK2D was significantly reduced upon miR-31 overexpression, while the mutant 3' UTR was not changed (Fig. 3a, 3b, and 3c) (P < 0.01), which demonstrated that miR-31 could bind to the 3' UTR of the CAMK2D gene. Then RT-qPCR and western blot were used to detect the expressions of CAMK2D at mRNA and protein levels with miR-31 overexpression and inhibition. The RT-qPCR results showed that the expression of CAMK2D was significantly decreased with the transfection of miR-31 mimic compared to the mimic-NC group (Fig. 3d) (P < 0.01), while its expression was significantly increased with the transfection of miR-31 inhibitor compared to the inhibitor-NC group (Fig. 3d) (P < 0.01). Western blot results further revealed that the overexpression of miR-31 inhibited CAMK2D expression at the protein level (P < 0.01), while the inhibition of miR-31 could increase CAMK2D protein expression (P < 0.05) (Fig. 3e and 3f). These results demonstrated that CMAK2D was a target gene of miR-31.

LncRNA MPNCR modulates CAMK2D by functioning as a ceRNA

We investigated whether MPNCR functions as a molecular sponge of miR-31 for the regulation of CAMK2D. The expression of CAMK2D was quantified by RT-qPCR and western blot following transfection with pcDNA3.1(+)-MPNCR and pcDNA3.1(+) vectors into BMECs. The RT-qPCR results showed that the CAMK2D mRNA expression was dramatically upregulated with the overexpression of MPNCR (P < 0.001) (Fig. 4a). The western blot analysis further demonstrated that the overexpression of MPNCR could significantly suppress the expression of CAMK2D at the protein level (P < 0.01) (Figs. 4b and 4c). Moreover, the rescue experiment was performed with the co-transfection of miR-31 mimic and pcDNA3.1(+) vector, miR-31 mimic and pcDNA3.1(+)-MPNCR vector, or pcDNA3.1(+)-MPNCR vector and mimic-NC into BMECs. The MTT assay showed that the promoting effect of miR-31 on BMEC cell viability was significantly inhibited with the co-transfection of MPNCR overexpression vector and miR-31 mimic compared to the control group (P < 0.05) (Fig. 4d). These results further confirmed that lncRNA MPNCR interacts with miR-31 and, as a ceRNA, inhibits the function of miR-31.

The objective of this study was to explore the potential regulatory and biological functions of the lncRNA MPNCR in the epithelial cells of the mammary gland. The number of mammary epithelial cells determines the milk production and lactation curve of dairy cows [36]. Therefore, the proliferation of BMECs is significant for lactation. Non-coding RNAs are untranslated RNA molecules that function to regulate gene expression in multiple biological processes [37]. LncRNAs lack an open reading frame, and they can act as a decoy for miRNAs resulting in release of miRNA-targeted mRNAs from silencing and thereby affect the expression of mRNA, protein, and the further function of targeted-genes [38]. Although several lncRNAs have been associated with lactation in cattle, little is known about their function and regulatory mechanism [31, 32, 39]. In a previous study using high-throughput sequencing analysis, we found that lncRNA MPNCR was highly expressed in lactating cows versus dry cows [32]. RT-qPCR in the current study verified this expression pattern. However, the function and regulatory mechanism of MPNCR in lactation are unknown. Therefore, BMECs were used in this study as an in vitro model to understand the function of MPNCR in bovine lactation. In exploration of the regulatory mechanisms of MPNCR, the MTT and EdU assays revealed that MPNCR was a negative regulator during bovine mammary epithelial cell proliferation.

In recent years, increasing evidence has suggested that lncRNAs contain binding sites for miRNA and function as molecular sponges to reduce the effect of miRNA on target mRNA [40–42]. The miR-31 has been found to promote mouse mammary epithelial cell proliferation and mammary stem cell expansion [43]. Interestingly, miR-31 had a higher expression in bovine mammary gland tissues in early lactation than in the dry period [44]. Bioinformatics analysis showed that lncRNA MPNCR had potential binding sites with miR-31. Indeed, the dual-luciferase reporter assay used in this study showed that MPNCR does interact with miR-31. Overexpression of miR-31 and MPNCR further confirmed that MPNCR contained the functional binding sites of miR-31. These results identified MPNCR as a lncRNA negative regulator of bovine mammary gland development that could inhibit the proliferation of BMECs through regulating the expression of miR-31.

MiRNA can directly bind to the 3' UTR of target mRNA to induce the target’s degradation or inhibit its translation. The Ca²⁺/calmodulin dependent protein kinase IIδ (CAMK2D) gene was found to be a target of miR-31. The Ca²⁺/calmodulin-dependent protein kinase (CAMK) is an extensively expressed, multifunctional Ser/Thr protein kinases, which function through Ca²⁺ signaling to regulate the β cells development [45]. The CAMKs family includes CAMKⅠ, CAMKⅡ, and CAMKⅣ, and each has many isoforms [46]. CAMKII is encoded by four genes (α,β༌γ༌δ)༌where δ isoforms are widely distributed in almost all tissues [47, 48]. The CAMKⅡ isoform participates in multiple cell proliferation. The CAMK2g is an inhibitor of myeloid leukemia cell proliferation and negatively regulates vascular smooth muscle cell proliferation [49, 50]. In myogenesis, a miR-31 overlapping lncRNA transcript controls myoblast differentiation [51]. Previous studies have demonstrated that CAMK2D was associated with vascular cell proliferation, differentiation, and apoptosis [52–54]. It has been reported that retinoic acid induces miR-31-5p expression and inhibits the proliferation and differentiation of C2C12 cells by suppressing CamkIIδ expression [55]. Based on bioinformatics analysis and its role in cell proliferation, in this study, CAMK2D was identified and verified as a target of miR-31, which was consistent with the above studies. The expression of CAMK2D was upregulated at the mRNA and protein levels when lncRNA MPNCR was overexpressed, while the expression of miR-31 was decreased (Fig. 5).

This study revealed the function and regulatory mechanism of lncRNA MPNCR in BMECs. LncRNA MPNCR inhibits the proliferation of BMECs by acting as a ceRNA that sponges miR-31 to upregulate the expression of CAMK2D (Fig. 5).

lncRNA MPNCR: mammary proliferation-associated long noncoding RNA;

BMECs: bovine mammary epithelial cells;

MTT: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide;

EdU: 5-ethynyl-2’-deoxyuridine (EdU);

RT-qPCR: real-time quantitative PCR;

DE: differentially expressed;

FBS: fetal bovine serum;

3’-UTR: 3’-untranslated region;

CAMK2D: calcium/calmodulin dependent protein kinase II delta;

MAPK6: mitogen-activated protein kinase 6;

MAPK14: mitogen-activated protein kinase 14.

EQUATIONS AND FORMULAS

1. ratio of EdU positive cells = (EdU staining cells/the total cells) ×100%.

2. relative luciferase activity = OD490 of Renilla/OD490 of Firefly

Author’s contributions

LX.W. performed the MTT, EdU, vector construction, RT-qPCR, western blot and wrote the draft. YL.Z. analyzed the data. LH.L., F.L. XL.Z. and WD.Z. cultured cells and performed western blot. H. K. participated in the experimental design and manuscript writing. X.W. designed the experiment.

Funding

The research was supported by the Natural Science Foundation of China (31772573), Genetically Modified Organisms Breeding Major Project of National Science and Technology Major Project (No.2018ZX08010-09B) and Program for New Excellent Talents in University (NCET-13-0485).

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

All the experimental procedures involving cows were reviewed and approved by the Experimental Animal Management Committee of Northwest A&F University (2011-31101684).

Consent for publication

Not applicable.

Competing interests

The authors declare tht they have no competing interests.

Author details

Key Laboratory of Animal Genetics, Breeding and Reproduction of Shaanxi Province, College of Animal Science and Technology, Northwest A&F University, Yangling, Shaanxi 712100, China
Department of Animal and Dairy Sciences, The University of Wisconsin, Madison, Wisconsin 53706, U.S.A.

Wiseman BS, Werb, Z. Stromal effects on mammary gland development and breast cancer. Science. 2002; 296:1046-9.
Raouf A, Zhao Y, To K, Stingl J, Delaney A, Barbara M, et al. Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell Stem Cell. 2008; 3, 109–18.
Richert MM, Schwertfeger KL, Ryder JW, Anderson SM. An atlas of mouse mammary gland development. J. Mammary Gland Biol. Neoplasia, 2000; 5: 227-41.
Ball R, Friis R, Schoenenberger C, Doppler W, Groner B. Prolactin regulation of b-casein gene expression and of a cytosolic 120-kd protein in a cloned mouse mammary epithelial cell line. EMBO J. 1988; 7, 2089-95.
Nørgaard JV, Theil PK, Sørensen MT, Sejrsen K. Cellular mechanisms in regulating mammary cell turnover during lactation and dry period in dairy cows. J. Dairy Sci. 2008; 91, 2319-27.
Capuco AV, Wood DL, Baldwin R, McLeod K, Paape MJ. Mammary cell number, proliferation, and apoptosis during a bovine lactation: relation to milk production and effect of bST. J. Dairy Sci. 2001; 84, 2177-87.
Stadaert L, Adriaens C, Radaelli E, Van Keymeulen A, Blanpain C, Hirose T, et al. The long noncoding RNA Neat1 is required for mammary gland development and lactation. RNA. 2016; 20, 1844-49.
Koirala P, Huang J, Ho TT, Wu F, Ding X, Mo YY. LncRNA AK023948 is a positive regulator of AKT. Nat. Commun. 2017; 8, 14422.
Kopp F, Mendell JT. Functional classification and experimental dissection of long noncoding RNAs. Cell. 2018; 172, 393-407.
Guttman M, Rinn JL. Modular regulatory principles of large non-coding RNAs. Nature. 2012; 482, 339-46.
Yu C, Li L, Xie F, Guo S, Liu F, Dong N, et al. LncRNA TUG1 sponges miR-204-5p to promote osteoblast differentiation through upregulating Runx2 in aortic valve calcification. Cardiovasc Res. 2018; 114, 168-179.
Fetica A, Bozzoni I. Long non-coding RNAs: new players in cell differentiation and development. Nat Rev Genet. 2014; 15, 7-21.
Quinn JJ, Chang HY. Unique features of long non-coding RNA biogenesis and function. Nat Rev. Genet 2016; 17, 47-62.
Tsai MC, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, et al. Long noncoding RNA as modular scaffold of histone modification complexes. Science. 2010; 329, 689-93.
Kino T, Hurt DE, Ichijo T, Nader N, Chrousos GP. Noncoding RNA gas5 is a growth arrest- and starvation-associated repressor of the glucocorticoid receptor. Sci. Signal 2010; 3, ra8.
Long Y, Wang X, Youmans DT, Cech TR. How do lncRNAs regulate transcription? Sci. Adv. 2017; 3, eaao2110.
Ginger MR, Shore AN, Contreras A, Rijnkels M, Miller J, Gonzalez-Rimbau MF, et al. A noncoding RNA is a potential marker of cell fate during mammary gland development. Proc Natl. Acad. Sci. U S A 2006; 103, 5781-6.
Askarian-Amiri ME, Crawford J, French JD, Smart CE, Smith MA, Clark MB, et al. SNORD-host RNA Zfas1 is a regulator of mammary development and a potential marker for breast cancer. RNA. 2011; 17, 878-91.
García-Venzor A, Mandujano-Tinoco EA, Lizarraga F, Zampedri C, Krötzsch E, Salgado R, et al. Microenvironment-regulated lncRNA-HAL is able to promote stemness in breast cancer cells. Biochim. Biophys. Acta. Mol. Cell. Res. 2019; 1866, 118523.
Rossi M, Bucci G, Rizzotto D, Bordo D, Marzi MJ, Puppo M, et al. LncRNA EPR controls epithelial proliferation by coordinating Cdkn1a transcription and mRNA decay response to TGF-β. Nat. Commun. 2019; 10, 1969.
Salmena L, Poliseno L, Tay Y, Kats L, Pandolfi PP. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 2011; 146, 353-8.
Tay Y, Rinn J, Pandolfi PP. The multilayered complexity of ceRNA crosstalk and competition. Nature. 2014; 505, 344-52.
Thomson DW, Dinger ME. Endogenous microRNA sponges: evidence and controversy. Nat. Rev. Genet. 2016; 17, 272-83.
Fang J, Huang C, Ke J, Li J, Zhang W, Xue H, et al. lncRNA TTN-AS1 facilitates proliferation, invasion, and epithelial-mesenchymal transition of breast cancer cells by regulating miR-139-5p/ZEB1 axis. J. Cell Biochem. 2020.
Zhang M, Wang F, Xiang Z, Huang T, Zhou WB. LncRNA XIST promotes chemoresistance of breast cancer cells to doxorubicin by sponging miR-200c-3p to upregulate ANLN. Clin. Exp. Pharmacol Physiol. 2020.
Grelet S, Link LA, Howley B, Obellianne C, Palanisamy V, Gangaraju VK, et al. A regulated PNUTS mRNA to lncRNA splice switch mediates EMT and tumour progression. Nat. Cell Biol. 2017; 19, 1105-1115.
Özdemir S, Altun S. Genome-wide analysis of mRNAs and lncRNAs in Mycoplasma bovis infected and non-infected bovine mammary gland tissues. Mol. Cell Probes. 2020; 50, 101512.
Li X, Wang H, Zhang Y, Zhang J, Qi S, Zhang Y, et al. Overexpression of lncRNA H19 changes basic characteristics and affects immune response of bovine mammary epithelial cells. PeerJ. 2019; 7, e6715.
Ma M, Pei Y, Wang X, Feng J, Zhang Y, Gao MQ. LncRNA XIST mediates bovine mammary epithelial cell inflammatory response via NF-κB/NLRP3 inflammasome pathway. Cell Prolif. 2019; 52, e12525.
Wang X, Wang H, Zhang R, Li D, Gao MQ. LRRC75A antisense lncRNA1 knockout attenuates inflammatory responses of bovine mammary epithelial cells. Int. J. Biol. Sci. 2020; 16, 251-263.
Zheng X, Ning C, Zhao P, Feng W, Jin Y, Zhou L, et al. Integrated analysis of long noncoding RNA and mRNA expression profiles reveals the potential role of long noncoding RNA in different bovine lactation stages. J. Dairy Sci. 2018; 101, 11061-11073.
Yang B, Jiao B, Ge W, Zhang X, Wang S, Zhao H, et al. Transcriptome sequencing to detect the potential role of long non-coding RNAs in bovine mammary gland during the dry and lactation period. BMC Genomics. 2018; 19, 605.
Huynh HT, Robitaille G, Turner JD. Establishment of bovine mammary epithelial cells (MAC-T): an in vitro model for bovine lactation. Exp. Cell Res. 1991; 197(2), 191-199.
Jiao BL, Zhang XL, Wang SH, Wang LX, Luo ZX, Zhao HB, et al. MicroRNA-221 regulates proliferation of bovine mammary gland epithelial cells by targeting the STAT5a and IRS1 Genes. J Dairy Sci. 2019; 102(1):426-435.
Zhang X, Cheng Z, Wang L, Jiao B, Yang H, Wang X. MiR-21-3p centric regulatory network in dairy cow mammary epithelial cell proliferation. J Agric Food Chem. 2019; 67, 11137-47.
Sorensen, M. T.; Nørgaard, J. V.; Theil, P. K.; Vestergaard, M.; Sejrsen, K. Cell turnover and activity in mammary tissue during lactation and the dry period in dairy cows. J. Dairy Sci. 2006, 89,4632−4639.
Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 2011; 147, 358-69.
Tong C, Chen Q, Zhao L, Ma J, Ibeagha-Awemu EM, Zhao X. Identification and characterization of long intergenic noncoding RNAs in bovine mammary glands. BMC Genomics. 2017; 18, 468.
Zhu M, Liu J, Xiao J, Yang L, Cai M, Shen H, et al. Lnc-mg is a long non-coding RNA that promotes myogenesis. Nat Commun. 2017; 8,14718.
Wang H, Huo X, Yang XR, He J, Cheng L, Wang N, et al. STAT3-mediated upregulation of lncRNA HOXD-AS1 as a ceRNA facilitates liver cancer metastasis by regulating SOX4. Mol. Cancer. 2017; 16, 136.
Wang X, Li M, Wang Z, Han S, Tang X, Ge Y, et al. Silencing of long noncoding RNA MALAT1 by miR-101 and miR-217 inhibits proliferation, migration, and invasion of esophageal squamous cell carcinoma cells. J. Biol. Chem. 2015; 290, 3925-35.
Lv C, Li F, Li X, Tian Y, Zhang Y, Sheng X, et al. MiR-31 promotes mammary stem cell expansion and breast tumorigenesis by suppressing Wnt signaling antagonists. Nat. Commun. 2017; 8, 1036.
Wang M, Moisá S, Khan MJ, Wang J, Bu D, Loor JJ. MicroRNA expression patterns in the bovine mammary gland are affected by stage of lactation. J Dairy Sci. 2012; 95, 6529-35.
Hook SS, Means AR. Ca(²⁺)/CaM-dependent kinases: from activation to function. Annu Rev Pharmacol Toxicol. 2001; 41, 471-505.
Tombes RM, Faison MO, Turbeville JM. Organization and evolution of multifunctional Ca(²⁺)/CaM-dependent protein kinase genes. Gene. 2003; 322, 17-31.
Soderling TR, Stull JT. Structure and regulation of calcium/calmodulin-dependent protein kinases. Chem. Rev. 2001; 101, 2341-52.
Saddouk FZ, Sun Y, Liu YF. Ca²⁺/calmodulin-dependent protein kinase II-γ (CaMKIIγ) negatively regulates vascular smooth muscle cell proliferation and vascular remodeling. FASEB J. 2016; 30(3), 1051-1064.
Si J, Collins J. Activated Ca2+/calmodulin-dependent protein kinase IIgamma is a critical regulator of myeloid leukemia cell proliferation. Cancer Res. 2008; 68(10), 3733-3742.
Soderling TR, Chang B, Brickey D. Cellular signaling through multifunctional Ca²⁺/calmodulin-dependent protein kinase II. J. Biol. Chem. 2001; 276, 3719-22.
Ballarino M, Cazzella V, D'Andrea D, Grassi L, Bisceglie L, Cipriano A, et al. Novel long noncoding RNAs (lncRNAs) in myogenesis: a miR-31 overlapping lncRNA transcript controls myoblast differentiation. Mol Cell Biol. 2015 Feb;35(4):728-36.
Saddouk FZ, Ginnan R, Singer HA. Ca(²⁺)/calmodulin-dependent protein kinase II in vascular smooth muscle. Adv. Pharmacol. 2017; 78, 171-202.
Cong W, Liu B, Liu S, Sun M, Liu H, Yang Y, et al. Implications of the Wnt5a/CaMKII pathway in retinoic acid-induced myogenic tongue abnormalities of developing mice. Sci. Rep. 2014; 4, 6082.
Anderson ME. CaMKII and a failing strategy for growth in heart. J. Clin. Invest. 2009; 119:1082-5.
Liu B, Liu C, Cong W, Li N, Zhou N, Tang Y, Wei C, Bai H, Zhang Y, Xiao J. Retinoid acid-induced microRNA-31-5p suppresses myogenic proliferation and differentiation by targeting CamkIIδ. Skelet Muscle. 2017, 7(1):8.

Download PDF

Version 1

posted

You are reading this latest preprint version

Long Non-Coding RNA MPNCR is a Negative Regulator of Bovine Mammary Epithelial Cell Proliferation

Status:

Version 1

Abstract

Figures

Background

Methods

RNA isolation and RT-qPCR

Plasmid construction

Cell culture and transfection

MTT assay and EdU staining

Nuclear and cytoplasmic RNA fraction

Western blot analysis

Results

LncRNA MPNCR inhibits BMECs proliferation

LncRNA MPNCR acts as a molecular sponge for miR-31

CAMK2D is the target of miR-31

LncRNA MPNCR modulates CAMK2D by functioning as a ceRNA

Discussion

Conclusions

Abbreviations

Declarations

References

Status:

Version 1