Cell culture and hypoxic treatment
MH7A is a cell line isolated from synovium of patients with RA, and it was purchased from BeNa Culture Collection (Suzhou, China). MH7A was inoculated in DMEM medium (Hyclone, New Zealand) containing 10% (v/v) fetal bovine serum (FBS, Biological Industries, Israel), 1% (v/v) 100 U/ml penicillin and 100 LG/ml streptomycin (Beyotime, Shanghai, China). OA-FLSs were isolated from the synovium of osteoarthritis (OA) patients and purchased from Bena Culture Collection (Suzhou, China). Cells were cultured at 37 oC with 5% CO2. 2% and 21% O2 were used as hypoxia and normoxia conditions. Cells was exposed to 2% O2, 93% N2, and 5% CO2 in a hypoxic chamber for 24 h.
Cell proliferation assay
Cell viability was determined by CCK-8 assay. Berifly, OA-FLSs or RA-FLSs were inoculated in 96 well plates, and the cells were cultured in an incubator at 37 ℃ and 5% CO2. The hypoxia condition of 2% O2 was established by placing cells in an hypoxia device (Aipuins, USA). After the culture, 10 μl of CCK-8 (Solarbio, Beijing, China) was added to each well, cultured in a 5% CO2 incubator at 37 ℃ for 1 h, and the optical density (OD) was measured at 450 nm.
Cell cycle analysis
According to different groups, OA-FLSs or RA-FLSs were cultured in the corresponding oxygen concentration of 35mm Petri dish for 24 h, and the cell precipitation was collected after trypsin digestion. After the cells were washed with PBS, 75% cold ethanol was added and fixed overnight at 4 ℃. Cells were centrifuged again, the precipitates were washed with PBS for 3 times and resuspended at 200 μl in PBS. 2μl RNase A with a concentration of 10mg/ml was added to the cell suspension for digestion for 30 min, and then 300 μl of propidium iodide (PI) at a concentration of 50 μg/ml incubated in dark for 30 min. The results of cell cycle were detected by flow cytometry.
BrdU assay
Cells were incubated with BrdU at room temperature for about 1.5 h. Cells were fixed by 4% paraformaldehyde at 4 ℃ for 20 min, and then infiltrated with 0.5% Triton X-100 for about 20 min. Finally, Hoechst staining was used for 15 min to label the nucleus. Subsequently, samples were observed under a fluorescence microscope, photographs were taken.
Annexin V-FITC/PI assay
Annexin V-FITC/PI double staining apoptosis detection kit was used to evaluate the induction of apoptosis. OA-FLSs or RA-FLSs were inoculated in 35 mm dishes. Cell precipitates were collected and stained with PI and AV-FITC according to the manufacturer's instructions (Bestbio, Shanghai, China), and samples were read by flow cytometry.
TUNEL assay
TUNEL cell apoptosis detection kit was used to detect the breakage of nuclear DNA in the late stage of apoptosis. TUNEL positive cells were detected according to the manufacturer's instructions (Servicebio, Wuhan, China). DAPI was used to label nuclei.
Mitochondrial membrane potential (MMP) polychromatic assay
MMP was measured with cationic JC-1 (5 ', 6,6' - tetrachloro-1,1 ', 3,3' - tetraethyl benzimidazolyl carbocyanine iodine) dye. Intact polarized mitochondrial membrane showed red signal (JC-1 aggregate), while green signal (JC-1 monomer) was depolarized mitochondrial membrane. After the cells were placed in a 35mm Petri dish for corresponding treatment, the cell precipitates were collected and stained with JC-1 dye according to the manufacturer's instructions (Solarbio, Beijing, China), and then the samples were examined by flow cytometry.
Reactive oxygen species (ROS) assay
The evaluation of cell ROS production is labeled with DCFH-DA probe (Beyotime, Shanghai, China), and the cells are added with DCFH-DA medium at a concentration of 10 μmol/ml and incubated at 37 °C for about 20 min. Then, the cells were washed three times with serum-free medium to remove the remaining probes. Cell precipitates were collected and each sample was analyzed by flow cytometry.
Western blot
To detect protein expression, Western blot was performed as previously described. First, the cells were washed three times under PBS at room temperature and then lysed in Ripa buffer containing 1 mM phenylmethylsulfonyl fluoride (PMSF). Subsequently, the cells were centrifuged at 4 °C for about 10 min to obtain the supernatant. Then, the protein concentration was detected by BCA protein quantitative kit. The target protein was separated by 12% SDS-polyacrylamide gel. About 50 mg of protein per sample was wet transferred to the NC membrane. The main antibodies used for immunoblotting are as follows: Bax (1:1000, Proteintech, No. 60267-1-ig), Bcl-XL (1:1000, Proteintech, No. 10783-1-ap), Beclin-1 (1:1000, Proteintech, No. 66665-1-ig), LC3 (1:1000, Proteintech, No. 14600-1-ap), BNIP3 (1:1000, ZEN BIO, 383308), HIF-1α (1:1000, ZEN BIO, 340462), cyclin D1 (1:1000, ZEN BIO, 382442), PCNA (1:1000, ZEN BIO, 385293).
The qPCR and RNA interference
qPCR analysis was performed according to our previous study. Primers for polymerase chain reaction are as follows: BNIP3, forward, TCCAGCCTCGGTTTCTATTT and reverse, AGCTCTTGGAGCTACTCCGT, GAPDH, forward, GCGGGAAATCGTGCGTGAC and reverse, CGTCATACTCCTGCTTGCTG. The mRNA level of each independently prepared RNA was determined by qRT-PCR in triplicate and normalized to GAPDH expression level. SYBR Green (Bimake, America) was used to quantify gene expression. The mRNA level of each independently prepared RNA was determined by qRT-PCR in triplicate and normalized to GAPDH expression level.
BNIP3 siRNA
The low expression of BNIP3 was achieved by invisible RNA system technology (Hanbio). The siRNA sequence of the control virus vector is as follows: SiRNA sequence: TTCTCCGAACGTGTCACGTAA. The siRNA sequence of the target gene is GGAATTAAGTCTCCGATTA. The transfection process was carried out according to the manufacturer's instructions. RA-FLSs were infected with virus with MOI value of 30 and cultured for 24 h. The culture medium containing virus was absorbed and replaced with fresh culture medium for 24 h. After transfection, the cells were exposed to normoxia or hypoxia for 24 h. Cell proliferation, apoptosis and autophagy were analyzed by real-time PCR and Western blot.
Statistical analysis
The statistical significance between the means was determined by t-test. The value of P<0.05 was considered statistically significant.