2.1 Animals
C57BL/6 male mice were used in all experiments. Male GCaMP 3+ mice and MrgprA3+ mice were used in confocal image experiments (Charles River, Wilmington, MA), each weighing 25–30 g and maintained on a 12-hour light/dark cycle. All animal welfare and experimental procedures were in strict accordance with the Guide for the Care and Use of Laboratory Animals and related ethical regulations of IBMS PUMC, according to the guidelines provided by the International Association for the Study of Pain and National Institutes of Health. Mice were given an adlibitum access to a standard diet and water. Mice were divided into a control group and a CCD group.
2.2. Surgical treatment
Under 3% isoflurane anesthesia, a midline incision was made along the back, and the intervertebral foramina of L3 and L4 were exposed after separating the paraspinal muscles from the mammillary process and the transverse process. CCD was induced by the insertion of an L-shaped stainless steel rod (0.3 mm diameter, each arm, 2 mm in length), into each foramen to compress DRGs [7].
The incision was closed in layers and topically treated with ointment containing an antibiotic (TriTop), which is a local anesthetic and an anti-inflammatory agent. A systemic antibacterial was also administered (Baytril, 10 mg/mL, i.m.).
After completion of all behavioral testing, mice were euthanized, and DRGs receiving CCD were microscopically examined to confirm rod placement, after removal of the epineurium and flushing with saline.
2.3.Behavioral assay
Three separate groups of mice were given subcutaneous injection of capsaicin (0.1, 1, 10 µg/10 µL;n = 6, 8, 6), histamine (10, 20, 50 µg/10 µL; n = 5, 8, 5),and BAM8-22(0.1, 1, 10 µg/10 µL; n = 5, 8, 8), into the calf of hind leg respectively and subsequent behavior was recorded for 30 min using a high definition camera on pre-CCD day 1 and post-CCD days 1, 3, 5,and 7. According to present studies, the injection of capsaicin brings out nociceptive (painful) sensations which lead to licking toward the injection site in calf models while pruritic stimulus generally arouses biting behaviors. Hence, the cumulative durations of licking and biting the injection site were counted viavideo, and used as an assessment of chemical-induced pain and itch, respectively.
The chamber was specially made from a cylindrical glass container (20 cm, diameter) with two small mirrors attached to plastic bricks placed as a right angle inside, offering a wide view of every act of the animal. There were 10 min of habituation before each test and recording started immediately after the injection.
2.4. DRG exposure surgery for in vivo imaging of the whole L4 DRG
For all imaging experiments, mice 8 weeks or older were anesthetized by injection of sodium pentobarbital (40–50 mg/kg, i.p.). After deep anesthesia was reached, the animal’s back was shaved and aseptically prepared, and ophthalmic ointment was applied to the eyes to prevent drying. During the surgery, mice were kept on a heating pad (DC temperature controller, FHC) to maintain body temperature at 37 ± 0.5 °C as monitored by a rectal probe.
Dorsal laminectomy of the DRG was performed at the spinal level L5 to L3 below the lumbar enlargement but without removing the dura. A 1.5 cm long midline incision was made around the lower part of the lumbar enlargement area, and these were dissected away to expose the lower lumbar part surrounding (L3-L5) vertebra bones. The L4 DRG transverse processes were exposed and cleaned. Using small rongeurs, the surface aspect of the L4 DRG transverse process near the vertebra was removed (only the L4 DRG transverse process was removed but the bone over the spinal cord was intact) to expose the underlying DRG without damaging the DRG and spinal cord. Bleeding from the bone was stopped using styptic cotton.
2.5. In vivo L4 DRG calcium imaging
In vivo imaging of whole L4 DRG in live mice was performed for 5 days after CCD surgery. After surgery, mice were placed in a prone position on a designed microscope stage. The spinal column was stabilized using clamps to minimize movements caused by breathing and heart beats. Mice were maintained under continuous anesthesia for the duration of the imaging experiment with 1–2% isoflurane gas using a gas vaporizer. Pure oxygen was used to deliver the gas to the mouse.
The microscope stage was fixed under a laser-scanning confocal microscope (Nikon C2 microscope system), which was equipped with a macro based large objective and fast EM-CCD camera. Live images were acquired for 8–10 frames at 600 Hz in frame-scan mode for 6–7 s, using a 5*0.5 N.A. macro dry objective, at a 512*512 pixel resolution with solid diode lasers (Nikon) tuned at a 448 nm wavelength, and emission measured at 500–550 nm for green fluorescence. For analysis, raw image stacks (512*512 pixels in the x-y plane; approximately 8 optical sections) were imported into a Nikon Instrument system-element for further analysis. DRG neurons were positioned at the focal plane and imaging was monitored during activation of DRG neuron cell bodies by peripheral chemical stimuli. Imaging parameters were chosen to allow repeated imaging of the same cell over many stimuli, without causing damage to the imaged cells or to surrounding tissue.
2.6.Calcium imaging measurement
Calcium imaging was conducted using a previously reported experimental method [19]. Briefly, we first chose neurons that respond to chemical stimuli as a region of interest (ROI). Then, we defined F0 as the average pixel intensity during the first 2–6 frames of every experiment. We then defined Ft asthe maximum fluorescence intensity after chemical stimulation. We used a formulaΔF/F= (Ft-F0)/F0 to express the neuronal response to chemical stimuli.We defines calcium transients as chemically induced if they occur between the beginning of the chemical injection and up to 7 s after the end of the injection. A ΔF/F ratiogreaterthan 0.8 was taken to indicate a positive neuronal response to the compound. Finally, the total number of reactive neurons was counted.
2.7 Confocal imaging of DRG MrgprA3 + neurons in vitro
Six male MrgprA3 mice were selected to make CCD model. On the fifth day after operation, laminectomy was performed. The intact L4 DRG was removed by ophthalmic forceps andplaced in aculture dish containing 37 °C artificial cerebrospinal fluid (ACSF). The whole DRG was scanned and photographed by Nikon stereoscopic confocal microscope. Neurons positive for MrgprA3 were excited at 448 wavelength, and emission measured at 500–550 nm for green fluorescence.
2.8.Immunofluorescence
Five days after CCD surgery, the L3 and L4 DRGs of five mice were removed after transcardial perfusion with PBS followed by 4% paraformaldehyde, and post-fixed in the same fixative for 4 h, before overnight cryoprotection in 30% sucrose. Tissue was frozen and sectioned at a 12 µm thickness by cryostat and processed for immunofluorescence labeling [20]. The sections were dried at 37 °C for 1 hr and fixed with 4% paraformaldehyde at room temperature for 10 min. The slides were preincubated in blocking solution (10% normal horse serum (vol/vol), 0.2% Triton X-100 (vol/vol) in PBS, pH 7.4) for 1hr at room temperature, then incubated overnight at 4 °C with primary antibodies. Secondary antibody incubation was performed at room temperature for 1 hr.
For primary antibodies, we used rabbit anti-CGRP (T-4239, Peninsula, 1:1,000), rabbit anti-HRH1 (13413-1-AP, 1:400), and guinea pig anti-TrpV1 (Abcam, 1:400).
For secondary antibodies, we used donkey anti-rabbit (A11008, Alexa 488 conjugated; A11011, Alexa 568 conjugated, Thermo Fisher), donkey anti-guinea pig (706-545-148, Alexa Fluor 680 conjugated; 706-625-148, Alexa Fluor 680 conjugated, Jackson lab). All secondary antibodies were diluted 1:500 in blocking solution. Following washes with PBS, the stained sections were mounted and cover-slipped with VECTASHIELD Mounting Medium (Vector Laboratories, Burlingame, CA, USA). The sections were examined and immunostaining images were obtained with an Olympus microscope.
For the analysis of immunohistochemical images, neurons exhibiting expression of at least one protein of interest (TRPV1 or/and H1R) were taken under consideration and analysed in a total of 12–16 randomly selected sections per group (4–6 sections per animal, 3 animals per group).
2.9. Quantitative Realtime-RT-PCR
The mRNA levels of TRPV1, Histamine receptor 1, Histamine receptor 4, and MrgprA3 receptor in the DRG were measured by real-time PCR (RT-qPCR). Total RNA was extracted using Trizol reagent according to the manufacturer’s instructions. The cDNA was synthesized from 1 µg of total RNA by the Prime ScriptTMRT reagent Kit with gDNA Eraser (Perfect Real Time). Each cDNA sample was amplified for the gene of interest and GAPDH in a 25 µL reaction volume using SYBR1 Premix Ex TaqTM II (TliRNaseH Plus). All primers used are listed in Table 1. The realtime RT-PCR conditions were 94 °C for 30 s followed by 40 cycles of 95 °C for 5 s, 55 °C for 30 s, and 72 °C for 60 s. The mRNA levels of all genes were normalized to GAPDH.
Table 1
The sequence of the primers used in the experiment.
Gene
|
Primer sequence (5’-3’)
|
Trpv1-F
|
CCGGCTTTTTGGGAAGGGT
|
Trpv1-R
|
GAGACAGGTAGGTCCATCCAC
|
Hrh1-F
|
CAAGATGTGTGAGGGGAACAG
|
Hrh1-R
|
CTACCGACAGGCTGACAATGT
|
Hrh4-F
|
GTCCCCTTGGCATTTTTAATGTC
|
Hrh4-R
|
ACATGCAGATTCCACTTCCAAA
|
Mrgpra3-F
|
CTCAAGTTTACCCTACCCAAAGG
|
Mrgpra3-R
|
CCGCAGAAATAACCATCCAGAA
|
2.10. Statistical analyses
For in vivo experiments, the animals were randomly distributed into various treatment groups. All of the results are given as means ± SEM. Normal distribution of data was assumed but not formally tested. The data were statistically analyzed with two-tailed, paired/unpaired Student’s t-tests and one-way or two-way ANOVA. When ANOVA analyses showed significant differences, pairwise comparisons between means were tested by the post hoc Tukey method (SigmaStat, San Jose, CA).