This study was approved by the Ethics Committee of the Foshan Sanshui District People's Hospital in accordance with the Helsinki Declaration of 1975 (revised in 2000). Informed consent was obtained from all individual participants included in the study. Ten postmenopausal women were recruited from July 2021 to October 2021. 5ml of bone marrow was aspirated from the anterior superior iliac spine in all patients during bone marrow puncture. Prior to the study, the study participants exhibited no mental, cognitive or mobility-related impairment. A diagnosis of PMOP was established with bone mineral density (BMD) T value ≤-2.5 measured by dual-energy X-ray absorptiometry. Patients with severe chronic diseases that cause metabolic abnormalities such as secondary PMOP and patients that received drug or hormone therapy within the past year were excluded.
BMSCs culture
5 mL bone marrow was collected in lithium heparin tubes. To establish an in vitro culture system for osteogenic differentiation of BMSCs, the bone marrow was evenly mixed with an equal volume of DMEM culture medium containing 1% double-antibody. The mixture was centrifuged at room temperature, and the supernatant was removed. The cells were re-suspended in a DMEM culture medium. The cell suspension was slowly added to an equal volume Percoll separation solution and centrifuged at room temperature. The middle layer of mononuclear cells was re-suspended with culture medium. After full mixing, a suspension containing BMSCs was obtained and cultured in a 5% CO2 incubator at 37℃. The fluid was changed every 24 hours; the cell morphology, size, and distribution were observed under an inverted microscope. After trypsin digestion, the DMEM medium was used to adjust the cell concentration to 2×105 and inoculated in cell culture plates and cultured. When the degree of cell fusion reached 70-80%, trypsin was digested, the digested cell suspension was collected and inoculated into a culture flask for subculture. Third-generation BMSCs in a logarithmic growth stage were added to an osteogenic induction solution (α-MEM culture medium containing fetal bovine serum, dexamethasone, ascorbic acid and β-sodium glycerophosphate) for three weeks. Cells were then collected, and the total RNA was extracted.
Identification of BMSCs
A BMSC suspension of 1×106 cells/ml was prepared. The cells were washed twice with cold PBS, centrifuged at 1,000 x g for 5 min at 4˚C, and re-suspended in 100 ml stain buffer. The re-suspended cells were incubated with phycoerythrin-labeled primary antibodies against surface markers CD34, CD45, CD73, CD90, CD105, and a corresponding isotype control antibody at room temperature, according to the manufacturer's protocol. The positively stained cells were analyzed by flow cytometry using FlowJo software 8.7.1. BMSCs from passages 3-6 were used in the experiments.
RT-qPCR
Total RNA was extracted from cultured cells or bone tissues using RNAiso Plus, and cDNA was synthesized using PrimeScript RT Master Mix. Real-time PCR was performed using primers synthesized by Thermo Fisher Scientific and SYBR Premix kit. The sequences of primers used are as follows: 5’ to 3’: Runx2-F CTCCTACCTGAGCCAGATGACG, Runx2-R GTGTAAGTAAAGGTGGCTGGATAGT; Osx-F CCAAGTGGGTGGTATAGAG, Osx-R GGGATGGTGGGTGTAAGA; FGF21-F GCCTCTAGGTTTCTTTGCC, FGF21-R GACTCCTGGTTGCTCTTGG; β-actin-F TGGCACCCAGCACAATGAA, β-actin-R CTAAGTCATAGTCCGCCTAGAAGCA. The PCR procedure consisted of denaturation at 94℃ for 5 minutes; 30 cycles of denaturation at 94℃ for 30 seconds; annealing at 58℃ for 30 seconds and extension at 72℃ for 40 seconds; extension at 72℃ for 10 minutes. β-actin was selected as the internal reference. Data were expressed using the comparative CT (2-ΔΔCT) method and normalized to β-actin.
Protein extraction and western blotting (WB) analysis
Cell samples were rinsed twice with cold PBS and harvested in the lysis buffer. The lysate was centrifuged at 4˚C/16,000g for 30 min, and the suspension was collected. Then, the protein content was examined using a BCA kit. Total proteins (20 µg) were separated by 12% (w/v) SDS-PAGE. The proteins were then transferred onto a polyvinylidene fluoride membrane. The membrane was washed and blocked with freshly prepared TBST containing 5% (w/v) non-fat dry milk for 90 mins at room temperature. The membrane was incubated with antibodies targeting FGF21 and β-actin overnight at 4˚C. After washing three times, the membrane was incubated with horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse secondary antibody for 1 h at room temperature. The membrane was again washed three times; then, the protein-antibody complexes were examined using an enhanced chemiluminescent detection reagent. Antibody signals were developed using a Bio-Rad XRS chemiluminescence detection system. Protein band densities were analyzed using Quantity One Software. The mean expression levels of the proteins relative to β-actin were presented [14].
Osteogenic differentiation and ALP/Alizarin Red S staining
ALP staining and Alizarin Red S staining were conducted on days 7, 14 and 21 of induction to assess ALP activity and calcium deposit formation. For ALP staining, cells were fixed with 10% formaldehyde for 15 mins, rinsed three times with deionized water, and treated with the BCIP®/NBT solution for 20 mins. After washing, the stained cultures were photographed. To measure ALP activity, cell lysates were tested using a commercial ALP assay kit. For Alizarin red S staining, BMSCs were stained with pH 4.2, 0.1% Alizarin red S for 5 mins, and the images were captured using a scanner. The calcium deposition was dissolved in 10 cetylpyridinium chloride, and the absorbance of the extracts was determined at 570 nm [14].
Cell transfection
We Purchased miR-26b-5p mimics, FGF21 mimics and the corresponding negative (NC), miR-26b-5p inhibitor and the control. Cells were seeded in six-well plates at a density of 5×105; when the cell fusion degree reached 90%, the culture medium was discarded, and cells were washed twice with PBS buffer and placed in 3ml of Opti-MEM culture medium in each well. The plasmids were diluted to 20uM with an Opti-MEM culture medium and transfection reagent. The corresponding groups of RNA were added to the transfection reagent, incubated for 20mins, and then added to the culture medium. After 6h of culture, it was replaced with an ordinary culture medium, and the expression level was verified after culture for 48h. miR-26b-5p and FGF21 were overexpressed for 48h, and then placed in an osteogenic induction medium for osteogenic induction culture, the expression of RNA was detect using RT-qPCR. Cells from miR-26b-5p group were collected on days 7, 14 and 21 of induction for ALP and alizarin red S staining. They were divided into four groups: BMSC group, BMSC+ osteogenic differentiation medium group, BMSC+ miR-26b-5p overexpression control group (NC), and BMSC+ miR-26b-5p overexpression group (mimics). The expressions of osteogenic specific genes Runx2 and Osx and target factor FGF21 were measured by RT-qPCR on day 7 of osteogenic induction. FGF21 was measured by western blotting in the miR-26b-5p overexpression group and in the miR-26b-5p inhibition group.
Dual-luciferase reporter gene assay
Using TargetScanFish software, we found miR-26b-5p may combine FGF21. We performed a dual-luciferase binding assay to verify the binding site and cloned FGF21 3'-UTR containing the predicted miR-26b-5p binding site in the pMIR-REPORTTM miRNA Expression Reporter vector. The plasmid was named pMIR-FGF21-WT (wild type). A mutated FGF21 reporter gene was created from the mutation-binding site region using a site-directed mutagenesis kit and named PMIR-FGF21-MT (mutant type). For transfection, cells were inoculated in 24-well plates, and 100ng pMIR-FGF21-WT or pMIR-FGF21-MT fluorescence reporter vector and 50ng miR-26b-5p mimics were co-transfected into 293T cells using Lipofectamine 2000. After 48h, luciferase activity was measured with the luciferase assay system according to the manufacturer's instructions.
Statistical analysis
All measurements were repeated three times and analyzed using SPSS (v.22.0). Differences between two groups were determined by the Student's t-test, while multigroup comparison was performed by one-way analysis of variance followed by Bonferroni's post hoc test. All data were expressed as mean ± standard deviation. A P-value less than 0.05 was statistically significant.