Pure culture of Xoo and evaluation of parents’ resistance level
Pure culture of the causal pathogen, Xanthomonas oryzae pv. oryzae (Xoo), isolate MX01410, which represent the dominant pathotype in Peninsular Malaysia was obtained from MARDI Seberang Perai in Pulau Pinang. The inoculum suspension was prepared for artificial inoculation using 48 hr old Xoo culture at a concentration of 108 cfu/mL at OD600 = 0.1. Parental rice varieties IRBB7 and MR219, as well as the other control varieties, MR263 and MR220CL2 were planted in the glasshouse located at MARDI Seberang Perai. Each test materials were planted as a single seedling per point with the distance of 0.25 m x 0.25 m to one another using randomized completely block design (RCBD) with 3 replicates. The plants were regularly maintained. The crops were fertilized with 100: 75: 103 kg/ha of N, P2O5, K2O. Insecticide was applied whenever necessary. The inoculation was done during the period from September 2018 to November 2018, by using the leaf clipping technique as described by Mew et al.,1982 (Mew, Cruz and Reyes, 1982). The tip of rice leaves (2 to 3 cm) of 40-day old rice was cut with a scissor dipped into Xoo bacterial suspension. The inoculated leaves were evaluated at 3, 5, 7, 9, 11, 14, 17, 19, 21, 23, 25, 27 and 30 days after inoculation. The infected leaves were rated according to lesion length (cm) as described in the Standard Evaluation System for Rice, 2013 (IRRI, 2013).
Plant DNA isolation and molecular analysis
The leaves of the BC3F3 plants were sampled at the young stage on the 30 days after sowing and stored in a -20oC deep freezer for long-term storage. These plant materials were then used for DNA extraction using TacoTM plant DNA/RNA extraction kits (GeneReach, Taiwan). The extracted DNA was diluted to 50% with elution buffer before the polymerase chain reaction (PCR) procedure. The PCR reaction mixture (10 µl) containing 1 µl of 50 ng/µl DNA template, 1 µl 10X buffer, 1 µl of dNTPs, 0.5 µl of 25 mM MgCl2, 6 µl of nucleus-free water, 0.1 µl of Taq DNA polymerase and 0.4 µl of 10 µM for each forward and reverse primers were prepared. Two polymorphic tightly linked markers namely ID7 (F:ATATTCACCAAATGATTCCCTG, R: ATACAAGCCTA AACCCATCTCA) and ID15 (F:ATACAGTGCCAATGATGAGGAG, R: CATACGAAACCCAACAGAAATAG) were used to detect the presence of Xa7 gene in the introgressed lines. (Zhang et al., 2009) The PCR amplification was performed using a thermocycler (Eppendorf Mastercycler gradient) as following this thermal cycling condition: pre-denaturation at 94oC for 4 min; then followed by 35 cycles of denaturation at 94oC for 30 sec, annealing at 54.8oC (ID7) or 44.6oC (ID15) for 45 sec, extension at 72oC for 1 min and final extension at 72oC for 1 min. The PCR products were then fractionated in 2% (w/v) 1X TBE agarose gels by electrophoresing at 80 V for 45 min in 1X TBE running buffer (Khan et al., 2015; Zhang et al., 2009). Then, the gel was photographed under ultraviolet light Biorad Gel Imager. A 100 bp DNA ladder was used as a reference size for the allele sizes of the amplified product. The allele size scoring was performed based on the size of control positive (IRBB7) and control negative (MR219) parents. The progenies with the same allele size with IRBB7 were scored as harboring resistant allele (R allele) meanwhile progenies with the allele size of MR219 were scored as harboring susceptible allele (S allele).
Development of Improved-MR219 resistant lines
Rice variety IRBB7 (harboring Xa7 gene) was used as the donor parent and MR219 (BLB-susceptible) was used as a recurrent parent. Markers were used to tag the Xa7 gene by using two STS markers namely ID7 and ID15. The crossing between MR219 and IRBB7 was initiated to produce the F1 seeds. The F1 seeds were then planted, genotyped, and selected for used as a female parent to be backcrossed with the recurrent parent to produce BC1F1 seeds. The BC1F1 seeds were planted, genotyped, and assessed for high similarity or closeness with the recurrent parent phenotypes before being backcross with MR219. Similar cycles of backcrossing, genotyping, and phenotypic assessments were followed until BC3F1 seeds were obtained. The selected BC3F1 individuals were allowed to be self-pollinated to produce BC3F2 seeds. The BC3F2 plants were genotyped and selected for further generation advancement until homozygous BC3F4 lines were identified. Nineteen BC3F4 lines with the Xa7 gene and two others without the gene were subsequently used in the subsequent studies.
Assessment of BLB resistance of the BC3F3 lines
All 21 BC3F3 lines seeds and parents were sown and planted for an assessment on their resistance against BLB infection. The experiment was conducted in a glasshouse at MARDI Seberang Perai, during the period from November 2018 to January 2019. The experiment was in a RCBD design with three replicates. Each replicate is represented by 10 plants per line, grown and arranged in trough box in the glasshouse. Inoculation was done as previously described. Lesion length (cm) was recorded after 25 DAI. The resistance level was categorized based on lesion length, as follow: 1–5 cm (Resistant, R), 5–10 cm (Moderately Resistant, MR); 10–15 cm (Moderately Susceptible, MS), > 15 cm (Susceptible, S), a classification class based on Standard Evaluation System of Rice (IRRI, 2013). Seeds of these plants were harvested as BC3F4 lines.
Agronomic performance of BC3F4 line
The field evaluation on the agronomic performance of the BC3F4 lines was carried out in the experimental plot at MARDI, Seberang Perai during the main season from January 2019 to March 2019. Seedlings at 20–25 days old age were transplanted as a single seedling per hill in a randomized completely block design (RCBD) with three replicates. The plot size was 4 m x 4 m, with 0.25 m x 0.25 m per planting distance. The crops were fertilized with 100:75:103 kg/ha of N, P2O5, K2O. Ten agronomic characteristics were evaluated according to the Standard Evaluation System of rice (IRRI, 2013). The characteristics investigated comprised of tiller number/plant, plant height (cm), panicle number/plant, days to 80% maturation, panicle length (cm), spikelet number/panicle, filled grains/panicle, 1000-grains weight (g), plant yield (g/plant) and yield based on crop cutting test (CCT) from 2 × 2 meter per plot (kg/ha).
Statistical analysis
Observed data were subjected to analysis of variance (ANOVA) using the Statistical Analysis System (SAS 9.4). The means were compared using Duncan’s Multiple Range Test (DMRT) to determine significant differences between tested varieties or lines at 5% probability for both disease assessment and agronomic performance studies. The relationship between agronomic characteristics and plant yield were then analyzed using simple correlation analysis.