Tissue samples and virus
Placenta samples were collected from healthy pregnant women (peripheral HCMV IgM negative) who voluntarily terminate the pregnancies in the first trimester (5-10 weeks). Samples were obtained from the Department of Obstetrics and Gynecology in Tai’an City Central Hospital between July 2016 and July 2018. All experimental procedures were approved by the medical ethics committee of the Taian City Central Hospital and patients informed consent agreement. HCMV AD169 was provided by the Hubei Provincial Institute of Virology and the TCID50 was 10-4.15/0.1 ml.
Isolation and culture of primary EVT
Isolation and primary culture of EVT was performed according to the protocol of Liu et al [11]. The human chorionic villi were washed with D-Hank’s to remove the decidua and matrix. The tissue was then cut into 1 mm3 pieces and incubated in enzyme mixture containing 4.2 mM MgSO4, 0.125% trypsin, 20 U/ml DNase I and 25 mM Hepes at 37℃ for 50 min. The 80 mesh (177 micron) and 300 metal mesh was used to filter the supernatant. The filtrate was centrifuged at 500× g for 10 min and the pellets were suspended in DMEM/F12 medium. 35%, 40%, 45% or 50% Percoll gradient solution were supplemented into the cell suspension and centrifuged at 1000× g for 25 min. The suspension from 40~45% Percoll gradient was washed twice and suspended in DMEM/F12 medium containing 10% FBS. The cell suspension was inoculated in 48 well-culture plates at a density of 5×104cells/cm2and cultured in 37℃, 5% CO2 for 24 h. The cells were then washed 3 times with sterile D-Hank’s and fresh DMEM/F12 medium was added.
EVT infection by HCMV
EVTs were inoculated in 6-well plates at a density of 5×104/cm2 and cultured at 37℃, 5% CO2 for 24 h. Then the DMEM/F12 medium was replaced with the HCMV culture medium. The virus group was inculated with 4 μL HCMV (TCID50:10-4.15/0.1 mL) for 2 h and the normal group was treated with PBS. The HCMV medium was discarded and cells were washed for 3 times with sterile D-Hank’s. The EVTs were cultured in fresh culture medium for 24 h or 48 h at 37℃, 5% CO2. Immunofluorescence staining was used to detect HCMVpp65 antigen.
MTT assay
Cells were inoculated in 96-well plates at a density of 103/ml. 200 μL of cell solution was added in each well and a blank control was added for each plate. The EVT culture medium was replaced with120 μL virus culture medium for each well. For the virus group, 10, 20, 30, 40, 50, 70 and 100 mol/L HCMV solutions were added to each well and the control group received the same volume of PBS. Two hours later, virus culture medium was replaced with 150 μL EVT culture medium.20 μL MTT solution was added to each well at 24 and 48 h respectively, and cells were cultured for another 4 hours. The medium was discarded and 150 μL DMSO were added to each well. The plate was shaken for 10 min. The OD value at 490 nm was measured to analyze the effects of HCMV on EVT proliferation. The minimum viral titer with a significant effect on cell proliferation was considered to be the optimal viral titer for inoculation.
Quantitative real-time polymerase chain reaction (qRT-PCR)
Total RNA of EVT from two groups was extracted with an RNA extraction kit (Takara, Japan). RNA was transcribed into cDNA using a reverse transcription kit (Takara, Japan). According to the sequences of genes, qRT-PCR primers were designed (Table 1). β-actin was designed as the internal standard. Quantification of mRNA was conducted using the Mx3005P real-time PCR instrument (Stratagene, Valencia, CA). The PCR reaction system contained 10 μL 2*SYBR Green general qPCR Master Mix (TaKaRa, Japan),8.8 μL 1:100 diluted cDNA and 0.6 μL upstream/downstream primer, respectively (10 μM). Cycle amplification conditions comprised an initial denaturation step at 95°C for 30 sec followed by 40 cycles at 95°C for 3 sec and at 60°C for 30 sec. Gene expression was normalized to Gapdh internal control. All values were then expressed relative to control samples using the 2–(ΔΔCT) method.
Immunocytochemistry (fluorescence) staining
Plastic coverslips placed in 6 well-culture plates was coated with mouse tail glue and primary EVTs were inoculated in above 6-well plates for 48h. Then coverslips were collected, washed three times with PBS and fixed for 30 min in a methanol-acetone (1:1) solution at room temperature. The coverslips were treated with 3% H2O2 for 20 min, 0.3% Triton X-100 for 30 min and 10% BSA for 30 min. For immunocytochemistry staining, EVTs were incubated in mouse anti-human CK7, anti-YAP, anti-Vim monoclonal antibody, rabbit anti-c-erbB-2 polyclonal antibody (1:100 diluted, Santa Cruz Biotechnology, China) at 4°C overnight. ALP-conjugated goat-anti-mouse IgG or goat-anti-rabbit IgG (1:50 diluted, Santa Cruz Biotechnology, China) at 37°C for 1 h. EVTs were stained with DAB (3,3′-diaminobenzidine) straining kit (Sangon Biotech, China) and the nucleus was strained with hematoxylin. For immunofluorescence staining, EVTs were incubated in rabbit anti-HCMVpp65 polyclonal antibody (1:100 diluted, Santa Cruz Biotechnology, China) at 4°C overnight, and then, incubated at 37°C for 1 h in Cy3-conjugated goat-anti-rabbit IgG (1:50 diluted, Santa Cruz Biotechnology, China) and incubated for 10 min with 10 µg/ml Hoechst 33342. Finally, coverslips were washed twice with PBS and flipped (the cell side now facing down) on top of 25 mL droplot of PVA-DABCO® mounting solution (Sigma-Aldrich) on glass slides. Straining observed with a microscope. Staining of EVTs were observed with a Leica laser scanning confocal microscope or the inverted microscope. The positive signal of antibody in immunocytochemistry staining appears as brown particle Fluorescence was detected with bandpass emission filters: 420–480 nm for Hoechst and 560–605 nm for Cy3, and the captured signals were recorded as blue, green and red, respectively.
Western blot
The total protein was extracted and the concentration was measured using a total protein extraction kit (BestBio, China), according to the manufacturer’s instructions. 50μg of total protein from each sample was separated on a 10% SDS-PAGE gel by electrophoresis and transferred to a PVDF membrane. The membrane was blocked in 5% skim milk at room temperature for 2 h and then incubated with mouse anti-YAP monoclonal antibody (1:500 dilution) overnight at 4℃. The membrane was then washed in TBST and incubated with the secondary antibody at room temperature for 2 h. The membrane was washed again in TBST, incubated with ECL reagent and protein bands were visualized under a gel imager. Gel image Quantity One analysis software was used to measure the absorbance values of the YAP protein and the internal control β-actin protein. The mean absorbance of the target protein over that of the internal control was used as the relative expression level of the target protein.
In vitro invasion assay
In vitro invasion assay was used for determining the invasive potential of EVTs. The Transwell chamber coated with Matrigel was placed in 24-well culture plates and 400 μL medium containing conditioned medium and complete medium (1:1) was infused into well out of chamber. In the HCMV group, EVT at 1×105/mL and 100 TCID50 HCMV 14.29 μL (with a total amount of 100 μL) was used in the Transwell chamber. In the control group, an identical volume of PBS was used instead of HCMV solution. After incubation for 24 h, the sample was fixed with formaldehyde, hematoxylin-stained and observed under an inverted microscope to count the number of cells migrating through the micropore membrane. For each sample, 10 randomly selected high power fields were counted.
siRNA and plasmid transfection
The YAP specific siRNAs and pcDH plasmid including negative control were designed and synthesized by RiboBio (Guangzhou, China). When cells grew to 50%–70% of confluence, transfection was performed according to instructions of X-tremeGENE™ HP DNA tansfection reagent and X-tremeGENE™ siRNA tansfection reagent (Roche, Switzerland). For plasmid transfection, 1 μg or 0.5μg pcDH was mixed with 200 μl opti-MEM in a sterile tube. Add 3 μl or 1.5μl X-tremeGENE HP DNA Transfection Reagent to the diluted DNA respectively (3:1 ratio of reagent to DNA) and mixed. For siRNA transfection, 0.66 μg or 1 μg siRNA was mixed with 50 μl opti-MEM in a sterile tube. Add 2 μl or 3 μl X-tremeGENE HP siRNA Transfection Reagent to the diluted siRNA respectively (3:1 ratio of reagent to DNA) and mixed. The above mixture was incubated for 15–30 min at room temperature. 200 μl transfection complex was added to the cells in a dropwise manner and cells were incubated for 24 h before measuring YAP1 mRNA level.
Statistical analysis
In all the experiments, each treatment was repeated at least three times. Data were analyzed using ANOVA when each measure contained 3 or more groups or using Independent-Samples T Test when each measure contained only two group. For ANOVA, a Duncan multiple comparison test was used to determine differences. The SPSS 18.0 software package was used for statistical analysis and data were expressed as mean ± SEM. P < 0.05 was considered to be statistically significant.
Table 1. Primer sequences information
mRNA
|
Primers (5'-3')
|
Mst1
|
Forward
|
CCCTGGGAATAACTGCCATA
|
Reverse
|
ATGAAGATTGCCCTCATTGG
|
Mst2
|
Forward
|
GCTTGGAGAAGGGTCTTATGG
|
Reverse
|
CATATGGGCTGTCACATTGC
|
Sav
|
Forward
|
CACACAAATAAGAAGGCCCAA
|
Reverse
|
TGGCTGGTATGTGACAGGAG
|
Lats1
|
Forward
|
ATACTTGGGGTTGCTGGGAC
|
Reverse
|
ATTAACTCTGGAGGGGAGAGCA
|
Lats2
|
Forward
|
CTCCGCAAAGGGTACACTCA
|
Reverse
|
GAGCGTGTTCTCCCAGTTGA
|
Mob1
|
Forward
|
TTCCAGAGGGTTCTCACCAG
|
Reverse
|
CACAGTGTTAACTGCAACCCA
|
YAP
|
Forward
|
GCAGTTGGGAGCTGTTTCTC
|
Reverse
|
GCCATGTTGTTGTCTGATCG
|
TAZ
|
Forward
|
CAGCCAAATCTCGTGATGAA
|
Reverse
|
TTCTGCTGGCTCAGGGTACT
|
TAED1
|
Forward
|
GCCCTGGCTATCTATCCACC
|
Reverse
|
TAGACACCTGTTTTCTGGTCCTC
|
TAED2
|
Forward
|
AGGCTTTCCAGACAATGGCA
|
Reverse
|
AAAAGCTCAGAGGCCTGGAC
|
TAED3
|
Forward
|
GACCCTGACACGTACAGCAA
|
Reverse
|
GAGCTCCTTCAATCCTCCCT
|
TAED4
|
Forward
|
GAGCAGAGTTTCCAGGAGG
|
Reverse
|
TCGTTCCGACCATACATCTT
|
β-actin
|
Forward
|
CATCCGTAAAGACCTCTATGCCAAC
|
Reverse
|
ATGGAGCCACCGATCCACA
|