RNA isolation and cDNA synthesis materials
Peripheral blood samples were obtained from the Department of Laboratory Medicine of 900th Hospital of the Joint Logistics Force. RNA was extracted from the peripheral blood of fifty two non-FXS individuals using RNA isolation kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol and stored at -80℃ for subsequent use. The quality of RNA was evaluated by Biophotometer (Eppendorf, Hamburg, Germany). Synthesis of the cDNA was carried out following the instructions of the manufacturer (Toyobo, Osaka, Japan).
Real-time reverse transcriptase PCR
qRT-PCR reactions were performed using iTaq SYBR Green Kits followed the 3-step cycles from the manufacturer’s protocol (Toyobo, Osaka, Japan). All reactions were carried out in triplicates and the cycles were run on Bio-Rad CFX96 real-time system (Bio-Rad, Hercules, CA, USA). The primers used were listed in Supplementary Tab. S1.
Bioinformatics
Four softwares were used to evaluate the splicing signals in this study, including ASD (http://www.ebi.ac.uk/asd), HSF (http://www.umd.be/HSF/), BDGP (http://www.fruitfly.org/seq_tools/splice.html), and ASPicDB (http://t.caspur.it/ASPicDB/index.php).
Western Blot
We used 10% polyacrylamide gel to separate target proteins, which were extracted from cell lysates using a lysis buffer (50mM Tris-HCl, pH7.4, 150mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS and protease inhibitor mixture). The protein concentration was determined by bicinchoninic acid assay protein assay (Bio-Rad, Hercules, CA, USA). The proteins were transblotted onto polyvinylidene fluoride membrane (BioRad, Hercules, CA, USA), and the membrane was blocked with Tris-buffered saline (TBS) containing 5% non-fat milk for 1 h, and incubated with a mouse monoclonal antibody anti-FMRP (Abcam, Cambridge, MA, USA) at 1:750 dilution for overnight incubation at 4℃. On the next day, the membrane was incubated with a horseradish peroxidase (HRP)-conjugated secondary antibody (Santa Cruz, Dallas, Texas, USA) at 1:5000 dilution for 1 h. The membrane was washed thrice, and enhanced chemiluminescence solution (ECL) (Beyotime, Shanghai, China) was added while exposing the film in accordance with conventional procedures. For the detection of BEX1 protein, a rabbit monoclonal anti-BEX1 (Abcam, Cambridge, MA, USA) primary antibody at 1:1000 and HRP-conjugated anti-rabbit secondary antibody were used.
Plasmids construction
HEK293T cells were obtained from Shanghai Cell Bank, Chinese Academy of Science. To identify the subcellular distribution of the end product encoded by the novel transcript containing the 140 bp sequence, we inserted the full-length coding sequence of FMR1 or fragment containing exons 1-9 and the 140 bp sequence into the eukaryotic expression vector pEGFP-N2 (BD Biosciences, San Jose, CA, USA). Full-length coding sequence of FMR1 gene was amplified with primers wFMR1-F and wFMR1-R (wFMR1-F: 5’-AAAGAGCTCGATGGAGGAGCTGGTGGTGGA AG-3’; wFMR1-R:5’-ACGCGCGACCGGGTACTCCATTCACGAGTG-3’;), whereas the fragment containing exons 1-9 and the 140 bp sequence was amplified with primers tFMR1-F and tFMR1-R (tFMR1-F: 5’-AAAGAGCTCGATGGAGGAGCT GGTGGTGGAAG-3’; tFMR1-R:5’-GCGTCGACCGACTTCAACCCTACTAAGT TCCTTGGA-3’). All primers contained the restrictive enzyme sites Sac Ⅰand Sal Ⅰ, for convenience of subcloning. For construction of the lentiviral overexpression vector, the target coding fragment was amplified using specific primers tFMR1-PF and tFMR1-PR with Not Ⅰand Mlu Ⅰsites, respectively (tFMR1-PF: 5’-AAAT ATGCGGCCGCATGGAGGAGCTGGTGGTGGAA-3’; tFMR1-PR: 5’-GCGACGC GTTCAGATCTTCAACCCTACTA A-3’). After the amplified product was linked to the lentiviral vector pLEX-MCS, the packaging plasmids pMD2.G and psPAX2 (Open Biosystems, Huntsville, USA) were used to co-transfect HEK293T cells using polyethylenimine (PEI) reagent (Sigma, St. Louis, MO, USA).
Cell culture and Transfection
HEK293T cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) medium with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). HEK293T cells were transfected with the recombinant eukaryotic vectors using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s instructions. Three days later, the cells were observed, and RNA/protein was extracted for subsequent use. As for the recombinant lentiviral vector, transfection of HEK293T cells followed the recommended protocol (Sigma, St. Louis, MO, USA) by use of PEI reagent. The virus supernatant of cells was collected per 24 h for 3 days and used to infect a new batch of HEK293T cells. The newly infected HEK293T cells were cultured in DMEM/F12 (1:1) medium with puromycin for about 15 days. Finally, stably transfected HEK293T cells were harvested.
Immunofluorescence
The subcellular distribution of proteins was examined by immunofluorescence staining. Specifically, the cells were fixed with 4% paraformaldehyde for 30 min, permeabilized with 0.5% Triton X-100 for 20 min, and incubated with 3% bovine serum albumin (BSA) for 1 h. Then, the cells were stained with the primary antibodies of interest, such as anti-FMRP and anti-BEX1 (Abcam, Cambridge, MA, USA) overnight at 4℃. On the next day, the cells were washed thrice with phosphate-buffered saline (PBS) and incubated with secondary antibodies Alexa Fluor® 594-conjugated goat anti-mouse IgG or goat anti-rabbit IgG for 2 h at room temperature (Santa Cruz, Dallas, Texas, USA). The cell nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI) dye for 5 min (Beyotime, Shanghai, China). Finally, we observed cells under an FV1000 laser-scanning confocal microscope (Olympus, Tokyo, Japan).
RNA microarray analysis
Total RNA was extracted from two batches of stably transfected HEK293T cells, including HEK293T cells transfected by void lentiviral vector (pLEX-MCS) and those by pLEX-MCS-tFMR1 vector. After the evaluation of RNA quality according to manufacturer’s protocol, RNA microarray hybridization was performed at Capital Bio Company (Beijing, China) and Affymetrix Human Genome U133 Plus 2.0 was used for analysis (Affymetrix, Santa Clara, CA, USA). For the functional analysis of the differentially expressed genes, DAVID (http://david.abcc.ncifcrf.gv/) database was also used.
Statistical analysis
All experimental data were expressed as means ± SEM. Data were analyzed using t-test by using SPSS 18.0. Differences were considered statistically significant at p<0.05 in all cases.
Accession numbers
Insertion sequence of FMR1 gene is available from GenBank MF593118. Sequenced reads have been deposited in the NCBI Gene Expression Omnibus (GEO) database (accession number GSE101830).