1.1 Sample source
1.1.1 Clinical samples
Thirty pairs of HCC patient tumors and adjacent tissues were obtained from Hangzhou Fuyang Hospital of Traditional Chinese Medicine. All patients received adjuvant therapy before surgery, including chemotherapy or radiation therapy. All patients were provided with the informed consent, and the study was approved by the ethics committee of Hangzhou Fuyang Hospital of Traditional Chinese Medicine.
1.1.2 Cell lines
The LO2 cell line (human immortalized normal liver cell line) and human HCC cell line (MHCC97, Huh7, SK-Hep1, Hep3B, and HepG2) were purchased from the Chinese Academy of Sciences.
1.2 Experimental method
1.2.1 Cell culture
The cells were cultured in DMEM medium (Gibco; Thermo Fisher Scientific) containing 100 U/mL penicillin (Sigma), 100 µg/mL streptomycin (Sigma), and 10% fetal bovine serum (Gibco; Thermo Fisher Scientific) and were kept at 37°C in a humid atmosphere with 5% CO2.
1.2.2 Cell transfection
Lentivirus-mediated sh-circDUSP16 (target sequence: ACCTGCTTGCAGGCTTTCAGT), plasmid-mediated circDUSP16, miR-136-5p mimic, miR mimic control, miR-136-5p inhibitor, and miR-136-5p inhibitor control were purchased from Genomeditech (Shanghai, China). According to the manufacturer's instructions, before transfection, HCC cells were seeded in a 6-well plate for 24 h. Lipofectamine 2000 reagent (Invitrogen, USA) was then used for the cell transfection.
1.2.3 Real-time quantitative PCR (qRT-PCR) analysis
According to the manufacturer's instructions, the RNAiso Plus kit (Takara) was used to extract total RNA from HCC cells, and the RNAiso kit (Takara) was used to extract miRNA. qRT-PCR was used to evaluate the expression levels of circDUSP16, miR-136-5p, and YAP1 in HCC tissue samples and cell lines. Specifically, the PrimeScript RT Reagent kit (Takara) was used to synthesize complementary DNA (cDNA) by reverse transcription of total RNA. Mix-X miRNA First-Strand Synthesis Kit (Takara) was used to synthesize the cDNA for miRNA. SYBR Premix Ex Tap (Takara) was used to carry out the qPCR and amplification was performed in LightCycler 480II (Roche, Switzerland). GAPDH was used as an internal control and the relative expression level of genes was calculated using the 2−ΔΔCt method.
1.2.4 Analysis of cell viability, colony formation, and apoptosis
According to the manufacturer's instructions, MTT was used to measure the cell viability at 0, 24, 48, and 72 h. A spectrophotometer was used to evaluate the spectrophotometric absorbance of each sample at 450 nm. To evaluate the formation of colonies, low-density cells were inoculated into Petri dishes 48 h after transfection, after visible colonies were formed, the colonies were counted after staining with 1% crystal violet. To determine the apoptosis, cells were plated in a 6-well plate at a density of 5×105 cells/well, and when the cells grew to the logarithmic growth phase, the cells were harvested and counted. After centrifugation, the cells were then resuspended by adding 195 µL Annexin V-FITC binding solution. 5 µL Annexin V-FITC and 10 µL propidium iodide staining solution were then added to mixed thoroughly. The cells were then incubated in the dark for 10-20 min and then analyzed by flow cytometry.
1.2.5 Western blotting
RIPA buffer (Beyotime, Shanghai, China) was used to extract proteins from cells. The BCA kit was used to determine the protein concentration and the loading buffer was used to denature the protein. The protein sample (20 µg) was electrophoresed on a 10% SDS-PAGE gel and after that transferred to a PVDF membrane (Millipore, USA). The PVDF membrane was blocked with 5% skim milk, then incubated with specific primary antibody overnight at 4°C. The antibodies used in the study were anti-YAP1 (1:1000; catalog number ab52771; Abcam) and anti-GAPDH (1:3000; catalog number 5174S; Cell Signaling Technology). Then the PVDF membrane and the secondary antibody were incubated for 2 h at room temperature. Enhanced chemiluminescence reagent (PierceTM ECL, Thermo Scientific TM, USA) was then used for protein detection.
1.2.6 Luciferase reporter gene experiment
The HCC cell line was seeded into a 24-well plate. After 24 h of incubation, the reporter vector containing wild-type (WT) or mutant (MUT) 3'UTR of circDUSP16 and YAP1 and miR-136-5p mimic were co-transfected into Huh7 and Hep3B cell lines. 48 h after transfection, Luc-Pair TM dual luciferase assay kit (Genecopoeia) was used to quantify the luciferase activity.
1.3 Statistical analysis
Statistical analysis was performed by SPSS 20.0 (IBM, SPSS, Chicago, IL, USA) and GraphPad Prism. The student independent or paired t-test and analysis of variance (ANOVA) were used to assess the statistical significance of the comparison between the two groups. Pearson correlation analysis was used to analyze the correlation. The Kaplan-Meier method and log-rank test were used to analyze the survival curve. P < 0.05 was considered statistically significant.