Animals
Adult Sprague-Dawley (SD) rats (260 ± 40 g) were from Animal Lab Center of Zhejiang Academy of Medical Sciences (SCXK 2019 − 0002, Zhejiang, China), and lived in a specific pathogen-free (SPF) lab. The rats were maintained under standard laboratory conditions and natural light-dark photoperiod. All animal operation rules and experiment procedure were permitted and approved by the animal ethics committee. SD rats were randomly divided into 4 groups, 8 in each group: sham operation (S) group; (I/R) group; I/R + ligustrazine preconditioning (Lig) group; I/R + ligustrazine preconditioning + mitochondrial permeability transition pore (mPTP) opener lonidamine (LND) (Lig + LND) group.
S group: SD rats underwent entire surgical procedures, but the left anterior descending coronary artery (LAD) was not ligated. I/R group: SD rats received saline intraperitoneally (i.p.) 5 min before ischemia and 10 min before reperfusion (10 mg/kg and 50 mg/kg saline) and underwent 30 min of ischemia followed by 2 h of reperfusion. Lig group: SD rats were treated with 10 mg/kg ligustrazine i.p. (5 min before ischemia), plus 50 mg/kg saline i.p. (10 min before reperfusion) and underwent 30 min of ischemia followed by reperfusion. Lig + LND group: SD rats were treated with 10 mg/kg ligustrazine i.p. (5 min before ischemia), plus 50 mg/kg LND i.p. (10 min before reperfusion) and underwent 30 min of ischemia followed by reperfusion.
Ischemia-reperfusion model
SD rats were anesthetized by 2% pentobarbital (i.p.), and were fixed in the supine position and connected to animal electrocardiogram (ECG). Heart rate, arrhythmias and ST-segment change were recorded by limb II of the ECG. After anesthesia, rats were intubated with endotracheal tubes and mechanically ventilated with oxygen-enriched room air. The rat heart was exposed from left side through incising the third and fourth ribs. Then, the pericardium was sheared gently and the LAD ligated with 5/0 silk suture. Except the ligation of LAD was not conducted, the same surgical procedures were performed in S group rats. Both ST-segment elevation, R wave broadening on the ECG and a turning in the color of the cardiac apex to purple white could confirm cardiac ischemia. Reperfusion was achieved with the snare loosening for 120 min after occlusion of 30 min. Blood samples were collected from abdominal aorta after reperfusion, centrifuged at 3600 r/min (4 °C, 10 min) in a high-speed refrigerated centrifuge. Plasma samples were extracted and saved at -80 °C for uniform measurement.
Myocardial injury marker analysis
The plasma levels of, cardiac troponin I (cTnI), creatine kinase-muscle/brain (CK-MB), and lactate dehydrogenase (LDH) released were measurements of the degree of cardiac injury. cTnI, CK-MB, and LDH kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) were adopted to measure the plasma levels.
Determination of SOD, MDA and ATP in myocardial tissues
After reperfusion, the left ventricular tissue was obtained and immediately stored at -80 °C. Heart tissues were homogenized with physiological saline at a 1:9 ratio (w/v, heart: saline) and centrifuged (3000 r/min, 15 min). The supernatant was applied to detect the activities of superoxide dismutase (SOD) and malondialdehyde (MDA) in myocardial tissues using assay kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). The ATP content was detected using an ATP Detection kit (Beyotime Biotech Inc, Shanghai, China). The specific operations were strictly followed by the instructions of the kits.
Measurement of UCP3 mRNA Expressions by RT-PCR
Total RNA was extracted using a TRIzol RNA extraction kit (Invitrogen, Carlsbad, CA, USA) and converted into cDNA. Quantitative polymerase chain reaction (qPCR) was utilized to measure the mRNA levels of UCP3. The relative levels of UCP3 mRNA were standardized through β-actin gene as reference. The primers used for PCR were listed in Table 1.
Table 1
Gene name | Primer sequence | Size (bp) |
UCP3 | F: 5’-3’GTGCTCGGTACCATCCTGACTA R: 5’-3’TGGAGTGGTCCGTTCCTTTG | 163 |
β-actin | F: 5’-3’TGTGCCCATCATGAGGGTTAC R: 5’-3’ATGTCACGCACGATTTCCCT | 150 |
Western blotting analysis
The UCP3 protein levels were analyzed by western blotting analysis. Frozen heart tissues were weighed and homogenized in the RIPA lysis buffer containing a cocktail of protease and phosphatase inhibitors using automatic tissue homogenizers. Homogenized samples were centrifuged at 12,000 g for 30 min to attain supernatant and recentrifuged to attain a clear lysate and all procedures were given out at 4 °C according to the producer’s instructions. Protein extracts were separated by electrophoresis on SDS-PAGE and then moved onto a polyvinylidene difluoride (PVDF) membrane. The membranes were blocked with 5% skimmed milk blocking buffer at indoor temperature for 1 h and incubated with primary (anti-UCP3) antibody overnight (18 h) at 4 °C. Afterwards, the membranes were washed and incubated with the secondary antibody. The protein bands were visualized with ECL plus reagent. β-Actin proteins were adopted as loading and internal controls. The data are exhibited as the grayscale proportion of the object protein to β-actin.
Measurement of area at risk and infarction area
LAD was ligated again at the original location and 2 ml of 2% Evans blue dye (Sigma, USA) was injected into the aorta to map the normally perfused region of the heart after 120 min reperfusion. The normal myocytes were displayed as blue region, while the ischemic area was displayed as the non-blue region. The heart was rapidly excised and frozen (30 min, -20 °C) and then cut transversely into five slices. Each piece of rat heart was 2 mm thick. The slices were incubated in 1% triphenyltetrazolium chloride (TTC) (Sigma, USA) in pH 7.4 buffer for 15 min at 37 °C to differentiate infarct area (IA) from ischemia zone, followed by fixation for 24 h in 10% formaldehyde. The IA cannot take up TTC stain and remain pale, while the viable tissue in ischemia area was identified as red staining by TTC. Morphometric measurements of the area at risk (AAR) and IA in each slice were analyzed with an image analysis software (Image-Pro plus 6.0). The proportion of AAR vs. left ventricle (LV) (AAR/LV) and IA vs. AAR (IA/AAR) were calculated.
Statistical analysis
All values are reported as means ± standard deviations (SD). Differences among experimental groups were determined by one-way analysis of variance (ANOVA), the LSD t test was performed for pairwise comparisons, using GraphPad Prism version 5 software. A value of P < 0.05 was considered statistically significant.