Spo23361 and Spo10340 are strongly expressed in roots and hairy roots
Five spinach genes, Spo23361, Spo10340, Spo16352, Spo12722 and Spo16366, were predicted from the spinach (S. oleracea) genome based on the similarity to the Arabidopsis AtCSLD3 gene (Favery et al. 2001). Phylogenetic analysis of the spinach and Arabidopsis CSLDs indicated that the five spinach genes clustered with different Arabidopsis CSLD genes respectively. Among them, Spo23361 and Spo10340 were clustered with AtCSLD2 and AtCSLD3 together (Fig. 1a). The open reading frames of Spo23361 and Spo10340 have 3,444 and 3,459 nucleotides, respectively. They encode two putative proteins containing 1,447 and 1,152 amino acid resides with similar molecular mass (128,557 Da and 130,011 Da) and pI (6.9 and 7.06), respectively. Pairwise comparison analysis showed that Spo23361 and Spo10340 exhibit 80% and 81% identity to both AtCSLD2 and AtCSLD3 (Fig. 1b), respectively. Conserved domain analysis showed Spo23361 and Spo10340 proteins have the conserved DDDQ/RxxRW motif (Richmond and Somerville 2000), indicating they belong to the CSL family (Fig. 1b).
The expression of five SoCLSD genes were examined in stems, roots, leaves, petioles, and flowers from two-month-old seedlings of spinach, as well as in hairy roots induced from leaves by A. rhizogenes strain LBA9402 using qRT-PCR analysis. Spo23361 and Spo10340 expressed in all these organs with similar patterns, and both of them showed obviously higher expressions in roots and hairy roots, respectively (Fig. 1c). Especially, the expression of Spo23361 was significantly higher in both roots and root hairs than that in other organs/tissues (Fig. 1c). In addition, the others (Spo16352, Spo12722, and Spo16366) were also highly expressed in roots.
All these implies that Spo23361 and Spo10340 would be good candidates for investigating the function of AtCSLD2 and AtCSLD3 homologues in root hair development of spinach using CRISPR/Cas9 gene editing system.
CRISPR/Cas9 vector construction and co-transformation efficiency in hairy roots
Partial sequences of Spo10340 and Spo23361 were amplified from cDNA of roots. Three targets were designed for each gene. The tRNA-gRNA cassette strategies were used to construct the CRISPR/Cas9 vector (Fig. S1) (Xie et al. 2015).
T-DNA of Ti plasmid harboring CRISPR/Cas9, tRNA-gRNA and bar expression cassette were transferred into leaf explants of spinach using A. rhizogenes strain LBA9402. Hairy roots appeared after 10-20 days of infection, which looked very similar with normal roots of spinach (Fig. 2a, b). Numerous independent transgenic hairy roots were produced for each construct (22 root lines for Spo10340, and 16 for Spo23361) (Fig. 2c, d). The PCR detection implied that rolB, Cas9, and bar genes were successfully transformed into the spinach, and about 80% hairy root lines (30 from 38 lines) were co-transferred into Ri T-DNA and Ti T-DNA (Fig. 2c, d).
Genotyping and phenotyping of edited hairy root lines of Spo26631
Total 15 hairy root lines of Spo26631 edited by CRISPR/Cas9 system were obtained (Fig. 3 and Table S1), among of which seven lines (i.e., line 2, line 3, line 4, line 8, line 12, line 13, and line 14) showed obvious phenotypes of short root hair (Fig. 3a, b). Besides, the abnormal middle and/or top of root hairs from these lines looked like bulging balls (Fig. 3a, b). Sequence analysis showed that all of seven lines were bi-allelic/homozygous mutated lines with edited sequence in the same or different target sites in two sister chromatids (Fig. 3e and Table S1). The root hair density of seven lines was not changed compared with that in normal hairy roots (Fig. 3f). However, the lengths of root hairs of seven lines were significantly reduced to the one twentieth of normal length (Fig. 3g). Another eight co-transferred lines were also sequenced. Among them, five heterozygous mutated lines (i.e., line 5, line 6, line 7, line 9, and line 11) contained one mutation type in each line, two chimeric mutated lines (line 1 and line 10) had three or two mutation types in each line, and the line 8 had a wide-type genotype in three target sites (Table S1). All of the heterozygous or chimeric mutated lines showed no difference in the length and density of root hairs when compared with normal hairy roots (Fig. 3c-g).
Genotyping and phenotyping of edited hairy root lines of Spo10340
Twenty-two hairy root lines were obtained for the gene Spo10340, among of which 15 lines were found co-transferred with rol B and Cas9 genes (Fig. 2d). No lines showed obviously stunted root hairs. The 15 lines were submitted to target sequence analysis. Among them, 13 lines (line 1 to line 13) were edited in more than one target sites, the remaining 2 lines had no change at the target sites. However, no bi-allelic and homozygous mutants were recovered. All of them were either chimeric or heterozygous lines (Fig. 4a-d and Table S1). The density and the length of root hairs were similar with those of normal hairy roots (Fig. 4e, f).
Mutation variety and frequency of CRISPR/Cas9- edited hairy roots
Fifteen co-transferred hairy root lines of Spo23361 and Spo10340 were performed PCR analyses, and their PCR amplicons with the target sites were sequenced. Among them, fourteen lines of Spo23361 and thirteen lines of Spo10340 showed mixed peaks, indicating that these lines were edited by CRISPR/Cas9 at the target sites (Table 1). The PCR amplicons from the 27 hairy roots were further confirmed by TA cloning and sequencing (Table S1). The editing efficiency varies widely among the three targets of each gene of Spo23361 and Spo10340 (Table 1). The third target site of Spo23361 and the first target site of Spo10340 showed the highest mutation rate of 86.7%. Four mutation types were observed, including replacement, insertion, deletion and combined mutations (i.e., more than one mutation type in one target site). For Spo23361, the insertion, deletion, and combined mutations occurred at the third target site, the replacement and deletion mutations occurred at the first target site, and only replacement mutation occurred at the second target site (Table 1). Interestingly, almost all the target sites except the first and second target of Spo23361 showed that the editing mode of deletion accounted for the majority. For Spo10340, four mutation types appeared at the first target site, while two mutation types (deletion and combined mutation) appeared at the second and third target site (Table 1).
Table 1
Detailed information of the mutation types of different targets in Spo23361 and Spo10340.
Gene
|
No. of hairy root lines
|
No. of hairy root lines with mutation
|
Target site/sequence
|
GC content (%)
|
No. of hairy root lines with mutation at different targets
|
Mutation rate (%) at different targets
|
Types of mutation (%)
|
i
|
r
|
d
|
c
|
Spo23361
|
15
|
14
|
1/GTGTCAAACTCCCTCTTTAC
|
45
|
3
|
20.0
|
0
|
66.66%
|
33.33%
|
0
|
2/CTCCTACCCAGCAGAGACGA
|
60
|
1
|
6.7
|
0
|
100%
|
0
|
0
|
3/AAACCAGAGTTCACAAACCA
|
40
|
13
|
86.7
|
4.76%
|
0
|
80.95%
|
14.28%
|
Spo10340
|
15
|
13
|
1/AACATCCAATGAGCAGGAGT
|
45
|
13
|
86.7
|
23.07%
|
7.68%
|
42.30%
|
26.92%
|
2/ACAAAGGGGACATATGGGTA
|
45
|
9
|
60.0
|
0
|
0
|
72.22%
|
27.77%
|
3/TTCTGGGATTCTTCCTCGTG
|
50
|
4
|
26.7
|
0
|
0
|
85.71%
|
14.28%
|
i: insertion, d: deletion, r: replacement, c: combined mutation (more than one mutation type in one allele). |
To detect the off-target events in CRISPR/Cas9 edited hairy roots of spinach, potential off-target loci following protospacer adjacent motif (PAM) sequences were predicted using the program written by Li et al (2017). They were highly homologous and not more than three mismatches of each target sequence in the hairy roots of Spo23361 and Spo10340 (Table S2). Only one off-target locus was predicted in the first and second target sequence of Spo23361, respectively. However, five off-target locus were found in the third target sequence of Spo23361 (Table S2). For Spo10340, there were one and two off-target sequences in the first and second target sequence, respectively. To examine whether these predictions happened in our results, 15 hairy root lines of Spo23361 and Spo10340 were submitted for sequencing, respectively, and no site mutation was detected (Table S2).
Transcriptomic analysis of CRISPR/Cas9 edited hairy roots
To evaluate the differentially-expressed genes (DEGs), the transcriptomics analyses of Spo23361 mutants and normal hairy roots were performed by using RNA-seq based on Illumina platform. A total of 25,495 unique genes were identified and quantified, 305 of which were more than 2.0-fold change (p < 0.05) in abundance and considered as DEGs in hairy roots of Spo23361 mutant when compared with normal hairy roots. The hierarchical clustering indicated that 305 DEGs were clustered into two main groups (Figure 5a and Table S3). Metascape analysis showed that 13 GO biological processes of the corresponding genes were enriched (Figure 5b, c and Table S4). Cluster I showed a significantly- reduced pattern of 169 DEGs in Spo23361 mutants. The 57 reduced DEGs in Cluster I were enriched in 13 GO biological processes including biosynthesis of salicylic acid, phenylpropanoid and flavonoid, response to salicylic acid, iron ion, bacterium, and hypoxia, metal ion and intercellular transports, defense response, protein folding, as well as cell death (Figure 5b, c and Table S4). Besides, 136 DEGs in Cluster II were induced in Spo23361 mutants. Among them, 32 genes were enriched in response to various stresses (e.g., salicylic acid, iron ion, hypoxia, and bacterium), ion transport, cell death, as well as biosynthesis of flavonoid and phenylpropanoid (Figure 5b, c and Table S4). Interestingly, DEGs were highly enriched in several clusters, including the metal ion transport (blue node), salicylic acid biosynthesis (yellow node), hypoxia (green node), flavonoid biosynthesis (purple node), and host interaction and intercellular transport (orange and dark green nodes) (Figure 5b and Table S4). In addition, these DEGs were enriched in several cellular components including cell wall, cell periphery, extracellular region, plasmodesma, plasma membrane, vacuole, and whole membrane (Figure 5d and Table S5), which indicated the cell wall modulation and membrane trafficking were seriously disturbed in the Spo23361 mutants.
To predict the relationship of DEGs in mutant roots, the Arabidopsis homologs of spinach proteins encoding by DEGs were found by sequence BLASTing in TAIR database (Table S6), and then were subjected to the web-tool SRING 10 for predicting protein-protein interaction (PPI) networks. The network showed 116 nodes (represent proteins encoding by DEGs) with 172 node degrees (represent PPIs) in mutants (Figure 5e and Table S7). The node colors with gradient from light blue to dark green indicated the node degree distributions (Figure 5e and Table S7). In this network, the dark green nodes represented cinnamyl alcohol dehydrogenase 3, calmodulin-binding protein 60-C, receptor-like protein kinase, and 70 kDa heat shock protein have more than 10 node degrees for each, implying their complicated interaction with other proteins. Interestingly, the nodes representing proteins encoding by DEGs for cell wall metabolism, protein folding and processing, membrane and transport, as well as signaling have more node degree than other nodes, suggesting that these signal and metabolic processes were obviously affected in mutants (Figure 5f, g, and Table S7). The transcriptomic results indicate that the gene expression patterns were significantly disturbed in Spo23361 mutants and might affect the root hair phenotype.