Specimen collection. Cancer tissues and adjacent normal tissues were collected from 25 patients (14 male, 11 female), who diagnosed with colon cancer at the First Affiliated Hospital of Soochow University (Suzhou, China) (August, 2020 to July, 2021). These patients received no treatment before and age of them was range from 37 to 72 old. The tissues were stored in liquid nitrogen immediately after resection. The present study was approved by the Ethics Committee of the First Affiliated Hospital of Soochow University (No. FAHSU20200719) and written informed consent was obtained from each patient.
Gene Expression Omnibus (GEO) data analysis. The present study analyzed the GSE121895 and GSE126094 datasets from the GEO database. The expression levels in each group were normalized. The threshold value of differentially expressed genes was set at two of different multiples and P<0.05.
Cell culture and transfection. The human colonic epithelial cell line (HFC) was purchased from ScienCell Research Laboratories, Inc. Colon cancer cell lines, including SW620, SW480, LOVO, HCT116 and DLD-1 cells were obtained from the American Type Culture Collection (ATCC). THP-1 cells were also obtained from ATCC. The cells were maintained in DMEM (Thermo Fisher Scientific, Inc.) containing 10% FBS supplemented with 100 U/ml penicillin and 100 g/ml streptomycin (Beyotime Institute of Biotechnology) at 37˚C. When the cell density (SW620, LOVO) reached 50-70%, the cells were transfected with miR-431 mimics (20 nM), mimics control, circCSPP1 pcDNA3.1 overexpression plasmid (1 µg/µL) or circCSPP1 pLVX-IRES-Puro silencing plasmid (shRNA1 and shRNA2; 1 µg/µL) for 24 h using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.) according to the manufacturer’s instructions. The miR-431 mimics, miR-control, circCSPP1 pcDNA3.1 overexpression plasmid, circCSPP1 pLVX-IRES-Puro silencing plasmids; Rho associated coiled-coil containing protein kinase 1 (ROCK1) and ZEB1 pLVX-IRES-Puro silencing plasmids were obtained from Shanghai Genepharma Co., Ltd. Phorbol-12-myristate-13-acetate (PMA), IL-4 and IL-13 were purchased from Sigma-Aldrich; Merck KGaA. The information of oligonucleotide was provided in Table 1.
Table 1
The information of oligonucleotide sequences
Gene | Sequence (5’-3’) |
ROCK1 shRNA | sense: CACCGCATTTGGAGAAGTTCAATTGCGAACAATTGAACTTCTCCAAATGC antisense: AAAAGCATTTGGAGAAGTTCAATTGTTCGCAATTGAACTTCTCCAAATG |
ZEB1 shRNA circCSPP1 shRNA1 circCSPP1 shRNA2 shRNA control miR-431 mimic mimic control miR-431 inhibitor inhibitor control miR-324-5p mimic miR-375 mimic miR-486-3p mimic | sense: CACCGAGAGAGAGAGTTTGACAAGGCGAACCTTGTCAAACTCTCTCTCTC |
antisense: AAAAGAGAGAGAGAGTTTGACAAGGTTCGCCTTGTCAAACTCTCTCTCTC sense: CACCGCTCCAGACAATGAAACATCCCGAAGGATGTTTCATTGTCTGGAGC antisense: AAAAGCTCCAGACAATGAAACATCCTTCGGGATGTTTCATTGTCTGGAGC sense: CACCGCTAATCAAGATACCTGTAGTCGAAACTACAGGTATCTTGATTAGC antisense: AAAAGCTAATCAAGATACCTGTAGTTTCGACTACAGGTATCTTGATTAGC sense: GATCCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAACTTTTTTG antisense: AATTCAAAAAAGTTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAACG UGUCUUGCAGGCCGUCAUGCA UUCUCCGAACGUGUCACGUTT UGCAUGACGGCCUGCAAGACA UUCUCCGAACGUGUCACGUTT CGCAUCCCCUAGGGCAUUGGUG UUUGUUCGUUCGGCUCGCGUGA CGGGGCAGCUCAGUACAGGAU |
Reverse transcription-quantitative PCR (RT-qPCR). TRIzol® reagent (Thermo Fisher Scientific, Inc.) was used to extract the RNA according to the manufacturer’s protocol. The RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara Bio, Inc.). The expression levels of miR-431, ROCK1 and zinc finger E-box binding homeobox 1 (ZEB1) were detected using a fluorescence quantitative PCR kit (Nanjing Jiancheng Bioengineering Inc.) in a BD FACSVerse™ (BD Biosciences). U6 and GAPDH were used as internal controls for miR-431 and mRNAs, respectively. Real-Time qPCRs were used three times: 2 minutes at 94°C, followed by 35 cycles (94°C for 30 s and 55°C for 45 s). The primers used were as follows: RT primer for miR-431, 5’-GTCGTATCCAGTGCAGGGTCCGAGGTGCACTGGATACGACACGUACU-3’; miR-431 forward, 5’-TGCGGUGUCUUGCAGGCCGUCAG-3’ and reverse, 5’-CCAGTGCAGGGTCCGAGGT-3’; U6 forward, 5’-CTCGCTTCGGCAGCACA-3’ and reverse, 5’-AACGCTTCACGAATTTGCGT-3’; ROCK1 forward, 5’-AACATGCTGCTGGATAAATCTGG-3’ and reverse, 5’-TGTATCACATCGTACCATGCCT-3’; ZEB1 forward, 5’-TTCTCACACTCTGGGTCTTATTCTC-3’ and reverse, 5’-CTTTTTCACTGTCTTCATCCTCTTC-3’; arginase-1 forward, 5’-AGACCACAGTTTGGCAATTGG-3’ and reverse, 5’-AGGAGAATCCTGGCACATCG-3’; IL-10 forward, 5’-AACCTGCCTAACATGCTTCG-3’ and reverse, 5’-GAGTTCACATGCGCCTTGAT-3’; circCSPP1 forward, 5'-CCATCCCATCAGTTCATCCT-3' and reverse, 5'-CCCTGCAAAAGGACTACAGG-3'; SMAD4 forward, 5'-GCTGCTGGAATTGGTGTTGA-3' and reverse, 5'-CTTCGTCTAGGAGCTGGAGG-3'; DAAM1 forward, 5'-TTCATTCATCTTTTGCTGTTTCCGA-3' and reverse, 5'-TTTTCTTCCTGGTCCTTTTTCTTGC-3'; CDK14 forward, 5'-GCACAGAGACCTGAAACCACAG-3' and reverse, 5'-AAAGATGCAACCTACTCCCCAC-3'; GAPDH forward, 5’-TCAAGAAGGTGGTGAAGCAGG-3’ and reverse, 5’-TCAAAGGTGGAGGAGTGGGT-3’. The data were quantified by using 2−ΔΔt method (21).
Cell Counting Kit-8 (CCK-8) assay. The SW620 or LOVO cells (3x105) were seeded in 96-well plates and cultured for 0, 24, 48 and 72 h. At each time point, the cells were incubated with 10 µl CCK-8 solution (Beyotime) at 37˚C for 4 h. The optical density was then measured at 450 nm as previously described (22).
Cell clonogenic assay. The cells (5x103) were suspended in DMEM containing 10% FBS, and then seeded into the plate. After 2 weeks of incubation at 37℃, the cells were fixed with 5 ml 4% paraformaldehyde for 15 min. The cells were then stained with Giemsa (Beyotime)for 30 min. The number of colonies was counted using a light microscope (200x; Nikon Corporation).
Transwell assay. The cells (2x104) were digested and cultured in a serum-free medium in the Transwell (BD) upper chamber with or without Matrigel (BD Biosciences). Subsequently, 600 µl complete medium (10% serum) were added to the lower chamber. After 24 h of incubation at 37℃, the cells in the lower chamber were fixed with 4% formaldehyde for 10 min at room temperature and stained with 0.1% crystal violet solution at room temperature for 10 min (Sigma-Aldrich; Merck KGaA). Finally, the migrated or invaded cells were photographed using a light microscope (200x)(23).
Fluorescence in situ hybridization (FISH) assay. Cy3-labeled circCSPP1 and FITC-labeled miR-431 probes (Biosense Technologies) were used to observe the co-localization of circCSPP1 and miR-431 in the cells. Hybridizations were performed according to the manufacturer’s instructions provided with the fluorescence in situ hybridization kit. The cell nuclei were stained with DAPI at room temperature for 20 min. Subsequently, images were visualized using a fluorescence microscope (200x) as previously described (24).
Luciferase assay. The luciferase assay was performed using the dual-luciferase reporting system psiCHECK (Thermo Fisher Scientific, Inc.). The wild-type (WT) or mutant-type (mut) sequences of circCSPP1, ROCK1 and ZEB1 were cloned into the psiCHECK2 plasmid. 293T cells (ATCC, 2x104 cells/well) were cultured overnight in 24-well plates. The cells were transfected with the WT or mut reporter vector along with miR-431 mimics (10 nM) or mimics control (10 nM) using Lipofectamine® 3000 (Thermo Fisher Scientific, Inc.). Finally, the luciferase activity of cells was detected with a Dual-Luciferase Detection kit (Promega Corporation) after 48 h of transfection. The data were quantified by normalizing to Renilla luciferase activity.
RNA pull-down assay. Biotin labeled miR-431 and the control probes were synthesized by Sangon Biotech (Shanghai) Co., Ltd. Probe-coated beads were generated by co-incubation with streptavidin-coated beads (Thermo Fisher Scientific, Inc.) at 25˚C for 2 h. The SW620 and LOVO cells were collected, lysed and incubated with miR-431 probes overnight at 4˚C. Thereafter, the beads were eluted, and the complex was purified using TRIzol® reagent (Takara Biotechnology Co., Ltd.). The levels of circCSPP1, ROCK1 and ZEB1 were then analyzed using RT-qPCR.
RNA immunoprecipitation (RIP) assay. RIP assay was performed using the EZ-Magna RIP RNA-Binding Protein Immunoprecipitation kit (MilliporeSigma). Briefly, magnetic beads conjugated with negative control normal IgG (cat.no. AB21-KC, 1:5,000) or anti-Ago2 (cat.no. 03-110, 1:5,000) antibody (MilliporeSigma) were co-incubated with the cell lysates for 4 h at room temperature. To investigate the enrichment of the binding targets, the immunoprecipitated RNAs were extracted and subjected to RT-qPCR.
Western blot analysis. RIPA lysis buffer (Beyotime Institute of Biotechnology) was used to extract protein from the cells. The protein concentration was determined using the BCA kit (Nanjing Jiancheng Bioengineering Inc.) according to the manufacturer’s instructions. Protein (40 µg) was then separated by using 10% SDS-PAGE, and transferred onto PVDF membranes (MilliporeSigma). The membranes were blocked in 5% skimmed milk for 1 h at room temperature followed by incubation with the following primary antibodies: ROCK1 (cat. no. #4035, 1:1,000, Cell Signaling Technology, Inc.), ZEB1 (cat.no. ab181451, 1:1,000, Abcam), cyclin D1 (cat. no. ab16663, 1:1,000, Abcam), cyclin-dependent kinase (CDK)4 (cat.no. 11026-1-AP, 1:1,000, ProteinTech Group, Inc.), p-CDK4 (1:1,000, Abcam), retinoblastoma (Rb; cat. no. ab181616, 1:1,000, Abcam), p-Rb (cat.no. ab184796, 1:1,000, Abcam), Snail (cat.no. ab216347, 1:1,000, Abcam), E-cadherin (E-cad; cat. no. 20874-1-AP, 1:1,000, ProteinTech Group, Inc.) and GAPDH (1:1500, cat. no. HRP-60004, ProteinTech Group, Inc.) at 4˚C overnight. The membranes were then incubated with HRP-labeled goat anti-rabbit secondary antibody (Abcam, cat. no. ab7090; 1:5,000) at room temperature for 1 h. Thereafter, an enhanced chemiluminescence kit (Thermo Fisher Scientific, Inc.) was used to detect protein expression.
Xenograft tumor model. Nude mice (n=24, 4-6 weeks old, 20-22 g) were obtained from the Animal center of Soochow University and randomly divided into four groups (shRNA2 ctrl, circCSPP1 shRNA2, pcDNA3.1 ctrl and pcDNA3.1-circCSPP1). All mice were housed in a SPF‑grade animal room (temperature 18‑22˚C; humidity 40‑60%; light/dark cycle 12/12 h each day) and had free access to food and water. The subcutaneous injection of colon cancer cells was performed after 3 days of adaptive breeding. Each mouse was subcutaneously injected with 3x106 colon cancer cells (100 µl in PBS). Tumor size was measured every 2 days, and the major axis (a) and minor axis (b) of the tumor were measured. The tumor volume was calculated using the following formula: ab2/2. At the end of the experiment, the mice were sacrificed using a 40% volume/min CO2 and the tumors were removed, photographed and weighed. The animal experiments were approved by the Ethics Committee of the First Affiliated Hospital of Soochow University (approval no. 20200917). The National Institutes of Health guide for the care and use of laboratory animals was strictly followed.
Isolation and characterization of exosomes. SW680 cells were cultured in DMEM supplemented with 10% FBS. Following 48 h of incubation at 37℃, the media were collected and centrifuged at 650 x g for 15 min, followed by 155,00 x g for 20 min at 4˚C (FBS was depleted of exosomes). The supernatants were then filtered (0.22 µm; MilliporeSigma) and centrifuged at 120,000 x g for 60 min at 4˚C. After washing with PBS, the exosome pellets were again centrifuged at 120,000 x g for 60 min at 4˚C. The quantity of exosomes was detected with BCA Protein Assay kit (Beyotime Institute of Biotechnology). Additionally, the particle size distribution of the exosomes was detected using NanoSight (Malvern Panalytical).
For observing the structure of the exosomes, transmission electron microscopy was used. Briefly, the exosomes were fixed with 2% paraformaldehyde and stained with 2% phosphotungstic acid (Beyotime) at 4℃ for 2 min. The samples were then observed using a transmission electron microscope (Hitachi, Ltd.). In addition, fluorescent PKH67 dye (Thermo Fisher Scientific, Inc.) was used to label the exosomes at 4℃ overnight and fluorescent Phalloidin dye (Thermo Fisher Scientific, Inc.) was used to label the cytoskeleton at room temperature for 2 h.
Cell cycle distribution analysis. SW620 or LOVO cells (5x105) were fixed using with 75% ethanol for 20 min on ice. Then, cells were permeabilized with 0.25% Triton X-100 and stained with PI/RNase (Sigma Aldrich). After 15 min of incubation at 4˚C, cells were analyzed using a flow cytometer (BD FACSAria III; BD Biosciences) and ModFit (version 3.0; Verity Software House, Inc.).
Statistical analysis. Three independent experiments were performed in each group. Statistical analysis was performed using GraphPad Prism software (GraphPad Software, Inc.). The measurement data are expressed as the mean ± standard deviation. The unpaired Student’s t-test was used for comparisons between two groups, and One-way analysis of variance and Tukey’s post hoc tests were used for comparisons between multiple groups (25). P<0.05 was considered to indicate a statistically significant difference.