Cell lines and culture conditions
Human RCC cell lines, 786-O and A498 were purchased from the Procell Life Science & Technology Co., Ltd., China. The cells were, respectively, maintained in Roswell Park Memorial Institute (RPMI) 1640 medium and Dulbecco's modified eagle's medium (DMEM) (Gibco, Life Technologies Inc.) supplemented with 10% fetal bovine serum (FBS) (Lonsera,S711-001S), 1% penicillin–streptomycin (10,000 U/ml penicillin and 10 mg/ml streptomycin, Gibco, Life Technologies Inc., cat#15140122). All cell lines were cultured at 37 °C in humidified atmosphere containing 5% CO2. The medium was replaced 2–3 times each week.
Cell transfection
The Lentivirus-based DIRAS2 overexpression system was purchased from GenePharma Company (Shanghai, China). Flag tag was fused to the C-terminus of DIRAS2. The lentivirus overexpressing DIRAS2 and negative control lentivirus were employed to infect the human ccRCC cell lines 786-O and A498. The stable infection cells were selected with 4 μg/ml puromycin (Solarbio, P8230). The transfection efficiency was verified by qRT-PCR and western blotting.
Quantitative real‑time PCR (qRT‑PCR)
Total RNA was extracted from cultured cells using RNA-Quick Purification Kit (Esunbio) pursuant to the manufacturer’s guidelines. Then, the concentration and purity of extracted RNA were assessed by a DS 11 Spectrophotometer (DeNovix, USA). The total RNA was then reverse transcribed to cDNA using a FastKing RT Kit (with gDNase) (TIANGEN BIOTECH), and then detected by qRT-PCR with a SYBR Green Realtime PCR Master Mix (Thermo). The primer sequences are shown in Table 1. The relative mRNA expression levels were calculated using the 2-∆∆CT method. Relative abundance of mRNA was calculated by normalization to GAPDH.
Table 1 Primer sequences in qRT-PCR
Target gene
|
Strand
|
Primer sequence
|
GAPDH
|
Forward
|
5’GCACCGTCAAGGCTGAGAAC3’
|
|
Reverse
|
5’TGGTGAAGACGCCAGTGGA3’
|
DIRAS2
|
Forward
|
5’TTGCAGATCACCGACACGAC3’
|
|
Reverse
|
5’CTGTCGGCTGGTAATGGAGT3’
|
Protein extraction and western blotting
Cells were lysed with RIPA lysis buffer (Solarbio) supplemented with PMSF (1%, v/v). The protein concentration was measured using an Enhanced BCA Protein Assay Kit (Beyotime). From each sample, 40 μg of total protein was separated by 8–12% sodium dodecyl sulfate-polyacrylamide gels (SDS-PAGE) and transferred onto hydrophobic PVDF membrane (Millipore). Membranes were blocked in 5% skim milk powder in TBS containing Tween 20 (0.1%, v/v) for 1 h at room temperature, and then incubated with primary antibodies overnight at 4 °C. Following the primary antibody incubation, the membranes were washed in TBST and incubated with HRP-conjugated secondary antibody for 1 h at room temperature. The protein bands were detected by ECL reagent (Millipore) and quantified by Image J (National Institutes of Health).
Primary antibodies against GAPDH (ab181603) and JNK (ab199380) were purchased from Abcam. Primary antibodies against DIRAS2 (TA809398) were purchased from Origene. Primary antibodies against Bcl-2 (AF6139), p-Bcl-2 (AF3138), Beclin-1 (AF5128) were purchased from Affinity. Primary antibodies against FLAG (#14793), SQSTM1/P62 (#5114), LC3B (#3868), p-SAPK/JNK (#4668), SEK1/MKK4 (#9152), P-SEK1/MKK4 (#4514), P38 MAPK (#8690) and p-P38 MAPK (#8690) were purchased from Cell Signaling Technology Inc. HRP-linked secondary antibodies directed against rabbit or mouse IgG, respectively, were purchased from Cell Signaling Technology Inc.
Patient samples
Clinical and molecular information of ccRCC samples from TCGA datasets are showed in Supplementary Tables. The transcription level analysis of DIRAS2 gene based on the three independent datasets from Oncomine database including Jones Renal, Gumz Renaland Lenburg Renal.
Fresh samples of human ccRCC tissue and paired normal tissue were obtained during surgery at the Department of urinary surgery, Qilu Hospital of Shandong University, China. All samples were collected with the informed consent of patients and the study was approved by the Ethics Committee of Qilu Hospital of Shandong University.
Immunohistochemistry (IHC)
The human ccRCC tissues obtained from the operation were fixed in 10% formaldehyde for 24 hours and then embedded in paraffin. The paraffin slices were prepared, deparaffinized, rehydrated, and treated with 0.01 M sodium citrate (pH 6.0) for 20 min at 98 °C for antigen retrieval. Then, endogenous peroxidase activity was blocked with H2O2 (0.3%, v/v) in distilled water, and goat serum in PBS (10%, v/v) was used to block non-specific antigens. Subsequently, slices were incubated with a mouse polyclonal DIRAS2 antibody (Origene, TA809398), diluted in 1% goat serum (1:500) at 4 °C overnight. After incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1h at room temperature, slices were incubated with 3,3'-diaminobenzidine (DAB, 25mg/ml) for 10 min. All tissue slices were counterstained with hematoxylin. Stained slides were viewed under the OLYMPUS DP27 microscope and analyzed by Image J.
Immunofluorescence
Cells on coverslips were fixed with methanol and blocked with goat serum (Origene, ZLI-9022). Then cells were incubated at 4 °C overnight with the primary antibody against LC3B (CST, #3868). After rinsing with PBS, coverslips were incubated with DyLight® 488, Goat Anti-Rabbit IgG (1:500, Abbkine, A23220), and the cell nuclei were stained with DAPI solution (Solarbio, C0065) for visualization. Three fields from each coverslip were randomly captured with Olympus DP72, and three independent experiments were performed. Quantification of LC3 puncta base on the fluorescence intensity was calculated with Image J.
Clonogenic survival assay
Cells were trypsinized to generate single-cell suspensions and seeded in six-well plates at 1000 cells per well. Then the cells were exposed to different doses of radiation (0 Gy, 2 Gy, 4 Gy, 6Gy) by a medical linear accelerator (varian 23 EX). After cultured for 7-14 days to allow cell colony formation, the cells were fixed in ethanol and stained with crystal violet for half an hour. Only colonies containing more than 50 wells were counted. The adherence rate was referred to the ratio comparing the number of colonies formed to the number of cells planted. Survival fraction (SF) is referred to the adherence rate at each dose divided by that at 0 Gy. The colony formation ability means the ratio of the SF of the transfected cells to the control cells under the same dose of radiation. The survival curves were calculated with Prism 7.0 (GraphPad Inc., La Jolla, CA, USA). The mean lethal dose (D0), quasi-threshold dose (Dq), and survival fractions at 2 Gy (SF2) were calculated by fitting the survival curves into the single-hit multitarget model (y=1−[1−e(−kx)]N ).
Statistical analysis
The statistical analyses were performed using the GraphPad Prismsoftware (GraphPad Software Inc., La Jolla, CA). For each experiment, at least three biological replicates were conducted, and data are expressed as mean ± SD, unless otherwise specified. Statistical significance was analyzed using a two-tailed Student's t-test or repeated measures ANOVA. Values of P < 0.05 were considered statistically significant.