2.1 Animals and virus
Six-week-old male BALB/c mice were purchased from Vital River Laboratory Animal Technology (Beijing, China). All animals were fed in the Experimental Animal Center of Shandong Provincial Hospital (Shandong, P.R. China). All animal experiments and procedures were approved by the Ethics Committee of Shandong Provincial Hospital, and the experiments were conducted in accordance with the Guide for the Care and Use of Laboratory Animals, 8th edition, published by the National Institutes of Health (NIH Publication No. 85-23, revised 1996)[22]. The CVB3 (Nancy strain) were prepared by passage through HeLa cell cultures. Virus titers were determined through a 50% tissue culture infectious dose (TCID50) assay of HeLa cells and calculated by the Reed–Muench method[23].
2.2 Experiment (in vivo)
Forty-eight male mice (18-20 g, 6 weeks old) were randomly assigned into 4 groups with 12 mice per group: Control, Dapagliflozin (a specific SGLT2 inhibitor, Bristol-Myers Squibb), VMC and the combination of VMC + Dapagliflozin. Mice were injected with 100 µl of phosphate-buffered saline (PBS) containing 103 TCID50 of CVB3 intraperitoneally at day 0 to establish a VMC model as previously described in the literature, while control mice were injected with 100 µl of PBS. Dapagliflozin (0.1 mg/kg per day) dissolved in 60% propylene glycol or control agent (60% propylene glycol) was given daily by gavage from day 1. At day 8, all the mice underwent echocardiography and were then executed, heart tissues and serum were taken for the next analysis.
2.3 Cell culture and treatment protocol
The Raw264.7 macrophage cell line was cultured in RPMI-1640 (Life Technologies, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS) (Life Technologies). 1×106 cells/well were seeded in 6-well plate and incubated in serum free medium overnight before treatment. To examine the effect of dapagliflozin, Lipopolysaccharides (LPS) (Sigma) was administered to stimulate M1 macrophage activation, dapagliflozin (10µM) was given at the same time, after 24h stimulates, the macrophages' phenotype distribution and inflammatory factors were observed.
2.4 Mouse cardiac echocardiography
Mouse cardiac echocardiography was operated in accordance with the manufacturers’ instructions. Mice were anesthetized by 2% isoflurane (supplied by Shandong Provincial Hospital). Then the cardiac function parameters such as left ventricular internal dimensions in systole (LVID-s) and diastole (LVID-d), left ventricular fractional shortening (LVFS) and left ventricular ejection fraction (LVEF) were measured. The experiment was conducted in a double-blind fashion.
2.5 Serological index measurement
Serum cardiac troponin I (cTNI) activities were tested by Shandong Provincial Hospital. The levels of serum IL-1β, IL-6, and TNF-α were determined by ELISA (eBioscience) following the manufacturer’s instructions. All samples were measured in triplicate.
2.6 Histopathological analysis
Heart samples were fixed in 10% buffered formalin solution and then embedded in paraffin. The samples were sectioned (5µm thick) and then stained with hematoxylin and eosin (Servicebio,Wuhan,China) according to the manufacturing instructions, and the degree of inflammation was determined under 200×magnification light microscopy. Myocardial histopathologic findings were quantified and scored for severity as follows: 0=no inflammation, 1=one to five distinct mononuclear inflammatory foci with 5% involvement or less of the cross-sectional area, 2=more than five distinct mononuclear inflammatory foci or over 5% but not exceeding 20% involvement of the cross-sectional area, 3=diffuse mononuclear inflammation involving over 20% of the area without necrosis, and 4=diffuse inflammation with necrosis. The analysis was performed in a double-blinded manner by a trained pathologist. Besides, myocardial fibrosis was determined by Masson staining (Servicebio,Wuhan,China) according to the manufacturing instructions. Myocardial cells were stained red and collagenous fibers were stained blue. Collagen area fraction (collagen area/field area×100%) was calculated by the Image-Pro Plus analysis system.
2.7 Immunofluorescence
Heart samples were fixed in 10% buffered formalin solution and then embedded in paraffin. The samples were sectioned (5µm thick). Incubate sections in 2 changes of xylene, 15 min each. Dehydrate in 2 changes of pure ethanol for 5 min, followed by dehydrate in gradient ethanol of 85% and 75% ethanol, respectively, 5 min each. Wash in distilled water. Immerse the slides in EDTA antigen retrieval buffer (pH 8.0) and maintain at a sub-boiling temperature for 8 min, standing for 8 min and then followed by another sub-boiling temperature for 7 min. Let air cooling. Wash three times with PBS (pH 7.4) in a Rocker device, 5 min each. Block endogenous peroxidase: wash three times with PBS (pH 7.4) in a Rocker device, 5 min each eliminate obvious liquid, mark the objective tissue with liquid blocker pen. Immerse in 3% H2O2 and incubate at room temperature for 25 min, kept in dark place. Then wash again three times with PBS (pH 7.4) in a Rocker device, 5 min each. Eliminate obvious liquid, mark the objective tissue with liquid blocker pen. Cover objective tissues with 10% donkey serum at room temperature for 30 min. Incubate slides with CD68 antibody (diluted at 1:200; Servicebio) overnight at 4 ℃, wash slides three times with PBS (pH 7.4) in a Rocker device, 5 min each. Cover objective tissue with Cy3 conjugated Goat Anti-Rabbit IgG (diluted at 1:200; Servicebio), incubate at room temperature for 50 min in dark condition. Wash slides three times with PBS (pH 7.4) in a Rocker device, 5 min each. Incubate slides with TSA-FITC solution for 10 min in dark condition. After that, wash slides three times with TBST in a Rocker device, 5 min each. Immerse the slides in EDTA antigen retrieval buffer (pH 8.0) and maintain at a sub-boiling temperature for 8 min, standing for 8 min and then followed by another sub-boiling temperature for 7 min, to remove the antibodies combined with tissue. Incubate slides with CD163 antibody (diluted at 1:1000; Servicebio) overnight at 4 ℃, placed in a wet box containing a little water. Wash slides three times with PBS (pH 7.4) in a Rocker device, 5 min each. Then throw away liquid slightly. Cover objective tissue with Cy3 conjugated Goat Anti-Rabbit IgG (diluted at 1:200; Servicebio), incubate at room temperature for 50 min in dark condition. Eliminate obvious liquid, incubate slides with spontaneous fluorescence quenching reagent for 5 min, then wash slides under flowing water for 10 min. Incubate with DAPI solution at room temperature for 10 min, kept in dark place. Wash three times with PBS (pH 7.4) in a Rocker device, 5 min each. Throw away liquid slightly, then coverslip with anti-fade mounting medium. Microscopy detection and collect images by Fluorescent Microscopy. DAPI glows blue by UV excitation wavelength 330-380 nm and emission wavelength 420 nm; FITC glows green by excitation wavelength 465-495 nm and emission wavelength 515-555 nm; CY3 glows red by excitation wavelength 510-560 nm and emission wavelength 590 nm.
2.8 Quantitative real-time PCR
Total RNA samples of myocardial infiltrating macrophages and cultured RAW264.7 were extracted with TRIzol reagent (Takara, China) in accordance with the manufacturer’s instruction. First-strand complementary DNA was synthesized using 1 µg of total RNA in a 20 µL reaction buffer containing MMLV-RT and oligo (dT) primers (Takara, China). The mixture was incubated at 42°C for 60 min, 70°C for 15 min, and then cooled to 4°C. To detect the expression of genes (TNF-α, iNOS, CD206, Arginase-1 and Stat3), cDNA was amplified with specific real-time PCR primers by using SYBR green real-time PCR kits (Takara, China). The following mRNA primer sequences were used:
Gene
|
Forward primer
|
Reverse primer
|
TNF-α
|
5′–TGTGCTCAGAGCTTTCAACAA–3′
|
5′–CTTGATGGTGGTGCATGAGA–3′
|
IL-1β
|
5′-GCAACTGTTCCTGAACT–3′
|
5′–ATCTTTTGGGGTCCGTCAACT–3′
|
iNOS
|
5′–CGAAACGCTTCACTTCCAA–3′
|
5′–TGAGCCTATATGCTGTGGCT–3′
|
CD206
|
5′–ACGAGCAGGTGCAGTTTACA–3′
|
5′–ACATCCCATAAGCCACCTGC–3′
|
Stat3
|
5′-ACGAAAGTCAGGTTGCTGCT-3′
|
5′–GCTGCCGTTGTTAGACTCCT–3′
|
β-actin
|
5′-TGTTACCAACTGGGACGACA–3′
|
5′–CTGGGTCATCTTTTCACGGT–3′
|
The quantified data were analyzed using the 2−ΔΔCt method[24].
2.9 Western blot analysis
Fresh myocardial tissue was lysed by RIPA lysis buffer (Nanjing, Nanjing, China) and proteins were extracted. Proteins were separated by SDS-PAGE and transferred to PVDF membranes. The membrane was closed with 5% bovine serum albumin and then incubated with the appropriate primary antibody overnight at 4°C, followed by washing with TBS-Tween and incubation with the appropriate secondary antibody at room temperature for 1 h. Spots were detected using an ECL system (amersham, UK) and optical density was measured using ImageJ software. The following antibodies were used: iNOS (Cell Signaling Technology, 13120S), CD206 (Abcam, ab125028), (Abcam, ab28946), IL-6(Cell Signaling Technology, 12912S), Stat3(Cell Signaling Technology, 9139S), Phospho-Stat3(Cell Signaling Technology, 9145S), GAPDH polyclonal antibody (Proteintech, No.10494-1-AP), and β-tubulin polyclonal antibody (Proteintech, No.10094-1-AP).
2.10 Statistical analysis
Survival rate was analyzed using the Log-rank test. Comparisons between two groups were performed with Unpaired t-test. For comparisons of three groups, One-way ANOVA analysis was used, followed by post-test using Tukey multiple comparison test. Correlations were determined by Pearson’s correlation coefficients. All statistical analyses were performed using the commercially available software SPSS version 20.0, GraphPad Prism version 7. The data are presented as the mean ± SD in the figures, with P<0.05 considered significant.