Animals
Male C57BL/6J background mice were obtained from CLEA Japan Inc. and Japan SLC, respectively, because male mice are reported to be more vulnerable to the effects of HFD on weight gain, metabolic alterations and deficits of learning, and hippocampal synaptic plasticity. These animals were housed three or four per cage in a standard 12 h dark-light cycle room at 25°C with freely available food and water. All animal experiments were performed in accordance with the guidelines of the Animal Experiment Ethics Committee of the University of the Ryukyus (approval number: A2019239). Time series changes in average food intake and average body weight in each condition were monitored.
Feed for control and high fat diet
In the case of the control diet (CD) for mice, we used CE-2 feed (Japan CLEA, Tokyo, Japan). The composition table of CE-2 feed is shown in Table S1; the total energy was 339.1 kcal/100 g, and crude fat was 4.61%. In contrast, in the case of high-fat diets (HFDs), we used F2HFD2 feed (Oriental Yeast Co., Ltd., Tokyo, Japan). The total energy of F2HFD2 was 640 kcal, consisting of 58% lard (wt/wt), 30% fish powder, 10% skim milk, and a 2% vitamin and mineral mixture (equivalent to 7.5% carbohydrate, 24.5% protein, and 60% fat)[19]. The other components of F2HFD were similar to those of CE-2. At 4 weeks of age, groups of mice were subjected to HFDs (F2HFD2 feed). Control mice were fed a low-fat diet (CE-2 feed).
Oral delivery of perampanel (PER)
HFD mice were orally administered with HydroGel (Clear H2O, Portland, ME 04101, USA) at a dose of 5 mg/kg body weight (HFD-fed mice with PER treatment group). In every HFD mice, one in one cage, PER was orally administered at a dose of 5 mg/kg body weight (HFD mice with PER treatment group), and both groups were monitored for body weight and intake of HydroGel twice a week to adjust the administration dose of PER to 5 mg/kg per body weight.
Wheel-running activity
Wheel cages (MELQUEST, Japan, Model RWC-15) were used to monitor individual mouse activity. Wheel rotation was monitored and recorded every 10 min for 14 days, as reported previously [20].
Open field test and elevated plus maze
Open field test: In a space surrounded by a 50 cm square and 40 cm high wall (Muromachi Kikai, Japan), mice were allowed to act freely for 5 min, and the trajectory was analyzed using a CompACT VAS/DV video-tracking system (Muromachi Kikai, Japan) [21]. Elevated plus maze: A space was elevated to a height of 50 cm from the floor, consisting of two open arms, two closed arms (30 × 6 cm each), and a neutral zone. Mice were placed in the center of the neutral zone, facing a closed arm, and allowed to move freely for 3 min. The time spent in the open and closed arms and the frequency of visits to the different arms were recorded and scored using the CompACT VAS/DV video-tracking system (Muromachi Kikai, Japan).
Novel object recognition test
Mice with CD, HFDs, and HFDs with PER treatment were handled for 5 min daily for 5 days prior to the start of the novel object recognition test. The mice were habituated to a 35 cm square and 25 cm high box for 10 min on day 1 and were provided with two identical objects (familiar object) for 10 min on day 2. On day 3, one of the familiar objects was exchanged with a novel object of different shape and color (Fig. 2f). The behavior of the mice was monitored for 5 min using a video camera, and the videos were digitized and stored on a personal computer. The search time for each object was measured via offline analysis [22].
Morris water maze
Memory impairment was assessed using the Morris water maze test, as previously described [23]. In summary, the water maze pool (Muromachi Kikai, Tokyo, Japan), with a diameter of 120 cm, contained opaque water (room temperature) with a platform (10 cm in diameter) submerged 2 cm below the surface. The hidden platform task took 4–7 days (two sessions per day, 3 hours apart), during which two trials were performed each day (15 min apart). The platform location remained constant, and the entry points were changed semi-randomly between the trials. Twenty-four hours after the last day of the hidden platform task, a 1 min probe trial was performed without the platform. The entry point for the probe trials was in the quadrant opposite to the target quadrant. Memory retention was evaluated by the amount of time spent in the correct quadrant where the escape platform was located in the hidden platform trial. The performance was monitored using the CompACT VAS/DV video-tracking system.
Pattern completion test mediated contextual and spatial recall
The Morris water maze task was conducted in mice with CD, HFDs, and HFDs with PER treatment as described previously [24]. All experiments were conducted at approximately the same time of day. The mice were transported from the colony to a holding area, where they were undisturbed for 30 min prior to the experiment. The test was performed in a rectangular dimly lit room with a circular pool (Muromachi Kikai, Tokyo, Japan), with a diameter of 120 cm, filled with opaque water made with skim milk (Morinaga, Japan) maintained at room temperature. Four large objects illuminated with floor lamps were hung on black curtains surrounding the pool as extramaze cues. A hidden circular platform (10 cm in diameter) was placed 1 cm below the water surface, and the mice were trained to find the platform with four trials per day for 12 days, with an inter-trial interval of approximately 60 min. During training, the mice were released from four pseudorandomly assigned start locations (N, S, E, and W) and were allowed to swim for 300 s. If a mouse did not find the platform within 300 s, it was manually guided to the platform and allowed to rest on the platform for 15 s.
A probe trial was conducted on day 13 under the full-cue condition (P1). The mice were released at the center of the pool and allowed to swim for 300 s in the absence of the platform. Following the probe trial, the mice received four training trials in the presence of the platform to avoid memory extinction that may have occurred during the probe trial. Subsequently, the mice received four probe trials with extra maze cue manipulations, one probe trial per day, without retraining between probe trials. For the one-cue probe trial (P2), one cue located more distally from the platform was kept, and the other three cues were removed from the surrounding curtains. For the two-cue probe trial (P3), one cue located close to the platform and the cue used in the one-cue probe trial remained, but the other two cues were removed from the surrounding curtains. For the no-cue probe trial (P5), all four extra maze cues were removed. Data for training and probe trials were collected and analyzed using the CompACT VAS/DV video-tracking system software. The escape latency to the hidden platform (goal arrival time) was measured.
Five-trial social memory assay
The five-trial social test was performed as described previously [25]. In summary, subject mice with CD, HFDs, and HFDs with PER treatment were individually housed for 7 days before testing to establish territorial dominance. On the day of testing, a female mouse was presented to the subject male mouse’s cage (Fig. 2g) for four successive 5 min trials with a 10 min inter-trial interval. In the fifth trial, a novel female mouse was presented (Fig. 2g), and the duration of the social investigation was recorded.
Contextual fear conditioning
Contextual fear conditioning was applied according to published protocols with slight modifications [26]. The mice were transported to an animal experimental room and allowed to acclimatize for at least 30 min prior to contextual fear conditioning training. The mice were then placed in the foot shock system model MK-450MSQ (Muromachi Kikai Co. Ltd., Japan) and allowed to explore for 2 min followed by three electric foot shocks (0.8 mA, 2 s, and 2 min intervals). Animals were left in the apparatus for a further minute before removal.
Acquisition of MRI data for mice
Anatomical brain images of 8 ex vivo mice with CD, HFDs, and HFDs with PER treatment were obtained using a Bruker BioSpec 117/11 11.75 Tesla MRI scanner (Bruker BioSpin GmbH, Ettlingen, Germany). A three-dimensional (3D)-prepared rapid gradient-echo (MPRAGE) sequence was acquired as high-resolution 100 µm isovoxel image of voxel-based morphometry (matrix size: 280 × 220 × 220; field of view: 28 × 22 × 22 mm; repetition time: 2000 ms; echo time: 1.78 ms; flip angle: 12 degrees; inversion time: 800 ms; echo train length: 13; numbers of average: 2). A rapid acquisition protocol by relaxation enhancement (RARE) sequence was used to draw the region of interest in the acquired data image (matrix size: 280 × 220 × 220; field of view: 28 × 22 × 22 mm; repetition time: 1500 ms; echo time: 25 ms; flip angle: 180°). We obtained MPRAGE and RARE images simultaneously in 1 single scan. MRI data acquisition of ex vivo mice was obtained from the heads of four mice that were fixed with PBS into the MRI coil simultaneously. Brains of the four mice were confirmed using raw MRI data. Rodent MRI was performed at the University of the Ryukyus under the OIST Sign Cooperation Agreement (Research theme: Medical impacts of brain volume control effect for reserve capacity of brain atrophy and delay the onset of symptoms of cognitive impairment - By using high resolution MRI analysis system-).
Image preprocessing and estimations for voxel-based morphometry analysis
Voxel-based morphometry (VBM) analysis and preprocessing of MPRAGE and RARE images were performed using the SPM8 analysis tool (Wellcome Department of Clinical Neurology, London; http://www.fil.ion.ucl.ac.uk) and SPMMouse toolbox (http://www.spmmouse.org/).The raw data were divided into four mice head MRI images and stored separately. The 3D (x–y–z–) coordinates of the divided images were transformed to the SPM standard coordinate system, and we defined the origin of the 3D coordinates as the bregma point. Then, the brain images were segmented into gray matter (GM), white matter, and cerebrospinal fluid using a segmentation tool (installed in the SPM8 system). The image was divided into GM images using tissue probability maps in the SPMMouse toolbox. These divided GM images were improved by contrast and normalized to the deformation of images. Finally, these images were smoothed using a 200 µm isotropic Gaussian kernel method (installed in the SPM8 system). A smoothed image was applied to the VBM analysis. The volume of hippocampal subfields (CA1, CA2, CA3, DG, and EC) was calculated using the ROI files [18, 27-29]. The differences among the mean values of the whole brain volumes from CD, HFDs, and HFDs with PER treatment were tested by one-way analysis of variance (ANOVA). When there was a significant difference between the three groups by ANOVA (p< 0.05), a Scheffe post hoc analysis (Scheffe) was performed between the CD vs. HFDs groups; CD vs. HFDs with PER treatment groups; and HFDs vs. HFDs with PER treatment groups.
Human subjects
The participants of this study were 117 healthy volunteers (mean age 37.8 ± 19.6 years; 65 females, 52 males) and five patients with benign tumors (mean age 55.5 ± 9.6 years; two females, three males), and all participants agreed in writing to participate in this study, in event-related memory tasks and T1-weighted imaging by 3-TMRI. The participants were divided into three groups based on body mass index (BMI) according to the WHO criteria: normal weight (BMI < 25), overweight (BMI ≥ 25 and < 30), and obese (BMI ≥ 30). There were 84 patients in the normal weight group (mean BMI 20 ± 1.8), 27 in the overweight group (mean BMI 26 ± 1.2), and 11 in the obese group (mean BMI 32 ± 2.3). All experiments were approved by the ethical committee of the University of the Ryukyus for medical and health research involving human subjects and were performed in accordance with guidelines of human experiment regulations at University of the Ryukyus (approval number:111).
Behavioral task paradigm
Details of the fMRI experiment of the event-related memory task used in this study are described in a previous report [17]. The memory task consisted of 108 photographs of 16 lure sets, 16 repeat sets, and 44 novel items. Participants were instructed to respond with buttons whether the photo stimulus shown on the display was a novel item (new), repeated photograph (same), or similar to but not the same as the previous photograph (lure). The button responses of the participants during the memory task were recorded on a personal computer, and the correct answer rates for new, same, and lure were calculated. The correct answer rate for each task (new task, lure task, and same task) was calculated using the following formula: The correct answer rate (%) = number of correct answers to the presented task / total number of presented tasks × 100. In our experiments, the total number of presented tasks for the new stimulus was set to 76, and the total number of tasks for the same and lure stimuli were both set to 16.
Functional MRI data acquisitions for behavioral task
Functional and structural images of the brain were obtained using 3T-MRI (Discovery MR750; General Electric, Milwaukee, WI). A sequence of echo planar imaging (EPI, repetition time: 1500 ms, echo time: 25 ms, flip angle: 70°, matrix size: 128 × 128, field of view: 192 × 192, in-plane resolution: 1.5 × 1.5 mm2, 23 slices, 3 mm thickness, 0 mm space) was used for the functional images for measuring BOLD contrast. The anatomical brain image was obtained using a three-dimensional (3D) spoiled gradient recalled echo (SPGR) sequence (1 mm slice thickness in sagittal section, matrix size: 256 × 256, field of view: 256 × 256 mm, repetition time: 6.9 ms, echo time: 3 ms, flip angle: 15°). A high-resolution T2-weighted fast spin echo sequence (matrix size: 512 × 512, field of view: 192 × 192 mm, repetition time: 4300 ms, echo time: 92 ms, in-plane resolution: 0.375 × 0.375 mm2, 23 slices, 3 mm thickness, 0 mm space) was obtained for visualizing the hippocampal structure and co-registration of 3D SPGR images and EPI functional images.
Imaging processing for behavioral task fMRI
Realignment, temporal correlation, spatial normalization, and spatial smoothing of the functional images were preprocessed and analyzed using SPM12. After preprocessing, the BOLD contrast images of new, same, and lure conditions of the individual subject were calculated from the functional image data: the hippocampal subregions as the CA3, CA1 and DG, and the perihippocampus region as the parahippocampus gyrus, perirhinal cortex, and entorhinal cortex were drawn manually with a pen tablet on the high-resolution coronal T2-weighted image based on the hippocampus atlas [30]. The percentages of signal changes in the BOLD response in the hippocampal regions of each subject were extracted using the MarsBar toolbox.3D-SPGR images were used for the analysis of voxel-based morphometry. The T1-weighted images were segmented into GM, white matter, and cerebrospinal fluid images using the SPM 12 segmentation tool. The volume of GM in the whole brain was calculated after spatial normalization and modulation of the GM image.
Image acquisition for functional connectivity analysis
MRI data were acquired using a GE Medical Discovery MR 750 3T scanner with a 32-channel head coil. Participants who lay on the scanner bed in the supine position were fixed to the head and neck by form pads and a Philadelphia neck collar to minimize head movement. Resting-state fMRI images were acquired using a single-shot EPI sequence covering the whole brain (42 axial slices, 4 mm thickness with no inter-slice gap; repetition time, 2000 ms; echo time, 30 ms; flip angle, 70°; matrix size, 64 × 64; field of view, 256 × 256). A total of 150 volumes were imaged over a single session. The anatomical brain images were acquired using T1-weighted, sagittal 3D SPGR sequences.
Data preprocessing and analysis for functional network
Image preprocessing and functional network analysis were performed using SPM12 and CONN toolbox 18.b (www.nitrc.org/projects/conn, RRID: SCR_009550) [31]. The details were described in a previous report [17]. Images were preprocessed in order of realignment, slice-timing correction, coregistration, normalization, smoothing, and segmentation. A noise of BOLD signal was removed by linear regression of potential confounding effects in the BOLD signal, and temporal band-pass filtering (temporal frequencies below 0.008 Hz or above 0.09 Hz).
We analyzed the default mode network (DMN) and functional connectivity in functional network analysis using the CONN toolbox. First as an individual analysis, regions with a positive correlation to BOLD fluctuations of a posterior cingulate cortex (PCC) and a precuneus were calculated as a DMN map. Next, regions with a negative correlation to the DMN map were calculated as anticorrelation DMN maps. Mean images of DMN map and anticorrelation DMN map of the normal weight, overweight, and obese groups were calculated using a one-sample t-test (voxel-level threshold of p<0.001 uncorrected, and a cluster-level threshold of false discovery rate [FDR] corrected p<0.05). In the functional combination analysis, we computed the nodes and edges in the graph theory parameters. The correlation coefficient of the fluctuation of BOLD signal between each ROI was calculated for seeds using the 132 × 132 ROI map (default ROI atlas of CONN toolbox)-based seed-based connectivity measure [32]. The ROI-to-ROI degree (number of edges that any node has between each node) and betweenness centrality (the number of shortest paths of a vertex that passes to any two pairs ( j, i ) of nodes within a graph) were calculated by an associated ROI-to-ROI correlation 132 × 132 matrix, established using our 132 × 132 ROI map. The degree is defined at each node as the number of edges from/to each node. Degree (di ) is defined as the following formula:\(di= \sum _{j}Ai,j\). where Ai,j is the associated ROI-to-ROI correlation of the 132 × 132 matrix. i = 1,2,3…..,132; j = 1,2,3….,132. Betweenness centrality (BCi) represents a hub that connects other functional modules and nodes [31], and BCi is defined as follows:\({BC}_{i}=\frac{{\sum }_{j,k\ne i}[i\in {P}_{j,k}]}{(N-1)(N-2)}\). where Pj,k is the number of nodes in the shortest path (shortest path when passing through any node defined with i as a variable) between each pair ( k, j ) of the nodes, and N is the total number of nodes in a graph of our ROI map. j, k≠i ; N = i x j = 1322. We calculated the mean value of each node and the number of edges in the normal-weight, overweight, and obese groups, respectively. In addition to the PCC and the precuneus in the DMN, the anterior cingulate cortex, cerebellar lobules CrusI, and hippocampus related to hippocampal memory function were set as regions of interest as reported previously [17], and the functional connectivity of the three groups was analyzed. A functional connectivity map of each group was illustrated using the BrainNet viewer (https://www.nitrc.org/projects/bnv/) [33].
Brain slices Ca imaging
Hippocampal brain slices were prepared from 17–18-week-old male C57BL/6J background mice, which divided the mice into CD, HFDs, and HFDs with PER treatment groups according to previous reports [34]. After cutting the slices (thickness, 300–400 µm) using the Linear Slicer (PRO 7N, Dosaka EM, Japan), hippocampal brain slices were incubated in the normal Krebs Ringer (125 mM NaCl, 2.5 mM KCl, 10 mM D-glucose, 1.25 mM NaH2PO4, 26 mM NaHCO3, 2 mM CaCl2, 1 mM MgCl2, continuously bubbled by mixture gas [95% O2; 5% CO2]) for 60 min at room temperature to recover the cutting damage. The Ca indicator Fluo-3 AM (excitation wavelength: 508 nm, emission: 525 nm, Kd, 0.4 µmol/L) (5 µM) (Dojindo, Kumamoto, Japan) was loaded into the brain slice preparations for 90 min. To monitor the [Ca2+]i, Fluo-3 fluorescence intensity (F525) was monitored using a photomultiplier under a confocal microscope (excitation wavelength 488 nm; LSM5 PASCAL, Carl Zeiss, Germany). In our experiment, a low-magnification (×2.5) objective lens (FLUAR 2.5×, NA=0.12, Carl Zeiss, Germany) was used to perform Ca imaging of the entire hippocampal slice (Fig. 1). Fluo-3 fluorescent images (512 × 512 pixels) were digitized and stored every 10 s for 50 min on a personal computer. Each F525 of CA1, CA2, CA3, DG, and EC regions was normalized (NF525) by the average value of F525 (from 0 to 5 min before AMPA or NMDA application) under offline analysis (Microsoft Excel, Microsoft Corporation, WA). During the Ca imaging, brain slices were continuously perfused (2 mL/min) by extracellular solution containing 125 mM NaCl, 2.5 mM KCl, 10 mM D-glucose, 1.25 mM NaH2PO4, 26 mM NaHCO3, 2 mM CaCl2, 1 mM MgCl2, and 1 µM tetrodotoxin continuously bubbled by mixture gas (95% O2; 5% CO2) in the perfusion chamber (35 mm µ-dish, Ibidi GMBH, Gräfelfing, Germany). In the case of the NMDA application, concentration of MgCl2 was set to 0 mM to prevent the Mg-dependent inhibition of NMDAR. Maximal value of NF525 was estimated as the maximal value of NF525 within 5 min after AMPA (Tocris, Bristol, UK) (100 µM) or NMDA (Tocris, Bristol, UK) (50 µM) application. We used the cyclothiazide (CTZ) (100 µM) or glycine (Tocris, Bristol, UK) (10 µM) to prevent the desensitization of AMPAR or to activate the NMDAR, respectively, and used the PER (Eisai Co., Ltd., Tokyo, Japan) (100 µM), GYKI (Tocris, Bristol, UK) (100 µM), or (2R)-amino-5-phosphonovaleric acid (APV) (Tocris, Bristol, UK) (50 µM) as an antagonist of AMPAR or NMDAR respectively. We also used 1-naphthyl acetyl spermine (NASPM) (Tocris, Bristol, UK) (20 µM) as an antagonist of Ca2+-permeable AMPAR [35] .
Surface AMPAR subunit of cross-linking with BS3
Hippocampal slices from 17–18-week-old male C57BL/6J background mice (CD, HFDs, and HFDs with PER treatment) were prepared as reported previously [34]. After preparing and recovering the hippocampal slice, we separated the CA1, CA2, CA3, DG, and EC regions from the hippocampal slice using an anatomical knife. CA1, CA2, CA3, DG, and EC regions were added to Eppendorf tubes (Eppendorf, Hamburg, Germany) containing ice-cold artificial cerebrospinal fluid (ARTCEREB; Otsuka Pharmaceutical Co., Tokyo, Japan) with 2 mM BS3 (Thermo Fisher Scientific, Wilmington, DE, USA). Incubation was performed for 30 min on ice. Cross-linking was terminated by quenching the reaction with 100 mM glycine (10 min at 4°C). Hippocampal subregions were resuspended in ice-cold lysis buffer containing protease and phosphatase inhibitors (25 mM HEPES, pH 7.4, 500 mM NaCl, 2 mM EDTA, 1 mM DTT, 1 mM phenylmethyl sulfonyl fluoride, 20 mM NaF, 1 mM sodium orthovanadate, 10 mM sodium pyrophosphate, 1× protease inhibitor mixture [Sigma-Aldrich, St Louis, MO], and 0.1% Nonidet P-40 [v/v)]) and homogenized rapidly by sonicating for 5 s. The total protein concentration of lysates was determined using the Lowry method. Samples were aliquoted (∼15 aliquots per mouse) and stored at -80°C for future analysis. BS3 samples were analyzed directly by SDS-PAGE without purification, and surface and intracellular bands were measured in the same lane, avoiding the need for normalization and increasing sample throughput. Total protein lysates (40 µg) were loaded and electrophoresed on a 5–10% Tris-HCl gel (Thermo Fisher Scientific, Wilmington, DE) under reducing conditions, and proteins were transferred to nitrocellulose membranes (Thermo Fisher Scientific, Wilmington, DE) for immunoblotting. Membranes were blocked with a blocking reagent, Blocking One (Nacalai Tesque, Tokyo, Japan), for 30 min at room temperature. Membranes were then incubated with anti-GluA1 (1:1000; Merck Millipore, Burlington, MA) and actin (1:5000, Protein Teck, Chicago, IL, USA) overnight at 4°C. Membranes were incubated for 30 min with HRP-conjugated anti-rabbit IgG (1:3,000; Cell Signaling Technology, Danvers, MA, USA) and washed extensively again in TBS-T. Membranes were immersed in chemiluminescence detecting substrate Chemi-Lumi One (Nacalai Tesque, Tokyo, Japan) for 1 min, and then detected using a LuminoGraph1 imaging system (Atto, Tokyo, Japan). The surface and intracellular bands in each lane were analyzed using a CS Analyzer (Atto, Tokyo, Japan).
RT-PCR
Hippocampal slices of 17–18-week-old male C57BL/6J background mice (CD, HFDs, and HFDs with PER treatment) were prepared as reported previously [34]. After preparing and recovering the hippocampal slices, we separated the CA1, CA2, CA3, DG, and EC regions from the hippocampal slices using an anatomical knife from 57BL/6J background mice. The CA1, CA2, CA3, DG, and EC regions of mice were isolated and immediately lysed with 0.5 mL TRIzol RNA isolation reagent (Thermo Fisher Scientific, Wilmington, DE) in a disposable homogenize tube BioMasher2® (Nippi, Tokyo, Japan). Total RNA was extracted individually from each region according to the rest of the protocol for the TRIzol RNA isolation reagent provided by the manufacturer (Thermo Fisher Scientific, Wilmington, DE). Using the PrimeScript RT Reagent Kit (Takara, Shiga, Japan), 1 µg of total RNA was reverse transcribed. An aliquot of the resultant cDNA was diluted 1:10 and added to a master mix of TB Green Premix ExTaq (Takara, Shiga, Japan), and real-time PCR was performed using a 7500 Fast Real-Time PCR system (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s instructions. The real-time PCR conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, and 60°C for 34 s. The fluorescence intensity at every annealing step was captured, and threshold cycle time values were determined using the 7500 software. The relative beta-actin expression levels were further normalized to the respective control (vehicle group). The relative expression level of a target gene in each sample was determined using the standard curve and further normalized to that of β-actin in the same sample. The primer and probe sequences for these genes are shown in Table S5. We defined “GluA2’s RNA amount/(GluA1+GluA3+GluA4’s RNA amount) ratio” as Ca2+-permeability index.
Sanger sequencing
Templates for the Sanger sequencing of the GluA2 editing site were prepared by amplifying cDNA with the following primer pair: forward primer, GAGGAATTTGAAGATGGAAGAGA, and reverse primer, AGGAGGAGATGATGATGAGGGT. PCR products (10%) were confirmed by agarose gel electrophoresis. After confirming the appropriate anticipated size, the PCR product was purified using the innuPREP PCRpure Lite Kit (Analytik Jena, Jena, Germany) according to the manufacturer’s instructions before direct sequencing. Cycle sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) and each of the primers mentioned above. Sanger sequencing analysis was performed using ABI3500 (Applied Biosystems, CA, USA) and sequence viewer software 4Peaks.
Editing assays
The Q/R editing state of GluA2 was analyzed using the QuantStudio™ 3D digital PCR system with a TaqMan® custom SNP genotyping assay (Thermo Fisher Scientific, Wilmington, DE). TaqMan probes were synthesized by Thermo Fisher Scientific and VIC-labeled probe was used to detect non-edited (Q) sequences and FAM-labeled probe was used to detect edited (R) sequences (5’ CATCCTTGCTGCATAAA 3’ and 5’ ATCCTTGCCGCATAAA 3’, respectively). The following primer pairs for amplification were used for PCR reaction: mice forward primer 5’ TTGGGATTTTTAATAGTCTCTGGTTTTCCTT 3’ and mice reverse primer 5’ GACCAACCTTGGCGAAATATCG 3’. cDNA of 5–50 ng was mixed with digital PCR master mix (Thermo Fisher Scientific, Wilmington, DE) and the mixed TaqMan probes were loaded onto the QuantStudio™ 3D digital PCR 20K Chip (Thermo Fisher Scientific, Wilmington, DE, USA) using an automatic chip loader according to the manufacturer’s instructions. Loaded chips were amplified using the Gene Amp 9700 PCR system (Thermo Fisher Scientific, Wilmington, DE, USA) under the following conditions: 96°C for 10 min, 39 cycles at 56°C for 2 min, and 98°C for 30 s, followed by a final extension step at 60°C for 2 min. After amplification, the chips were imaged using a QuantStudio 3D Instrument (Thermo Fisher Scientific, Wilmington, DE, USA). For analysis of the chip data, QuantStudio 3D Analysis Suite Cloud Software (Thermo Fisher Scientific, Wilmington, DE) was used for the relative and quantitative data analysis.
Golgi staining and acquisition of images of the whole hippocampus
The coronal sectioned mice brains from Bregma -0.94 mm to Bregma -4.04 mm (including dorsal to ventral, medial to lateral whole hippocampus, 5 mm in width) was fixed by 4% paraformaldehyde for 2 days, then stained by a Golgi Cox stained system (FD Rapid GolgiStain™ Kit, MD 21041, USA). The impregnated tissues were cut into 100 µm sections and counterstained with crystal violet, and the total number of the 15 µm spines in the apical dendrites of CA1 and DG, as well as the percentage of morphological spines (thin, stubby, and mushroom), were examined using Axio Observer Z1 (Carl Zeiss, Germany). Another set of paraformaldehyde-fixed 5 mm width coronal sections of the brain including the whole hippocampus was processed using the passive CLARITY technique method (PACT) [36] and examined through Lightsheet Z.1 (Carl Zeiss, Germany) using a 10X clearing objective, and 3D images of the whole hippocampus of Thy1-YFPH transgenic wild type mouse (The Jackson Laboratory, stock number: 003709, strain name: B6.Cg-Tg.(Thy1-YFP)16Jrs/J) [37, 38], HFD-fed mice, and HFD-fed mice with PER-treatment were obtained, respectively. We acquired the maximum intensity projection image along the z-, time-, or channel dimensions, which created an output image where the pixels contained the maximum value over all images in the stack at a particular pixel location. With the Z-stack function, a series of XY images in different focus positions can be acquired, resulting in a Z-stack. In this way, a 3D dataset 400 µm × 400 µm × 400 µm from the specimen in each dorsal to lateral and medial to lateral CA1, CA3, and DG was obtained. The gallery view displays images from the z-stack within a time series.
Quantitative analysis of Thy1-YFPH+-cell number
3D reconstruction was completed using the Arivis Vision four-dimensional (4D) software. Blob finder (filter) was used to the rounded 2D and 3D segments close to the sphere-like shapes in a noisy image. Using the Gaussian scale, we found the object seeds and a watershed algorithm to identify the object boundaries. We set the average size of the structure of interest to 20 µm and the threshold to 5. High-resolution rendering is an approach for visualizing the current view in a higher image and data resolution.
Immunohistochemical analysis
Mouse brains were perfusion-fixed in 4% paraformaldehyde and embedded paraffin and cut into 4 micrometer-thick sections used for the immunohistochemical analysis of monoclonal antibodies for DCX (E-6 monoclonal, 1:50, Santa Cruz Biotechnology Inc., Dallas, USA), MAP2ab (AP-20 monoclonal, 1:100, SIGMA-ALDRICH, St. Louis, USA), GluA1 (AB1540 polyclonal, 1:100, EMD Millipore Corp., Burlington, USA), and GluA2 (AB1768-1 polyclonal, 1:5, EMD Millipore Corp., Burlington, USA), respectively.
Quantitative immunostaining area by ZEISS ZEN Intellesis software.
Acquisition of immunostained area in each MAP2, GluA1, and GluA2 expression area was performed using AxioVision (Carl Zeiss, Germany) microscopy (20X objective lens) with a ZVI format. Generating data image processing with image segmentation was performed using machine learning with ZEN Intellesis software. More than 1000 cells were examined in each group. One-way ANOVA was used to test the variance among the three groups, excluding data of 3SD or more. Then, we used the following sample numbers: HFD series: MAP2 CD n=731, HFDs n=288, HFD+PER n=225;GluA1 CD n=220, HFD n=156, HFD+PER n=94; GluA2 CD n=78, HFD n=114, HFD+PER n=182; GluA2/GluA1 CD n=78, HFD n=94, HFD+PER n=94. The Bonferroni method was used for post-hoc testing to analyze significant differences among the groups.
RNA-seq analyses
The sequenced raw RNA-seq fastq reads were aligned to the mouse GRCm38 (ensemble release 104, http://ftp.ensembl.org/pub/release-104/fasta/mus_musculus/dna/) genome using HISAT2 (v.2.2.0). The average mapping rate for all the samples was 94.21% (range 88.70–96.30%). Aligned reads were quantified using Salmon (v.0.14.2), and TPM values were calculated using StringTie (v.2.1.2). Variant calling was performed according to GATK Best Practices for RNAseq short variant discovery using the GATK package (v.3.8). Adding read group information, sorting, marking duplicates, and indexing were carried out using Picard’s tools. The GATK tool Split N Cigar Reads was used for splitting reads into exon segments and hard clipping any sequences overhanging into the intronic regions. Variant calling and filtration were performed using GATK HaplotypeCaller and VariantFiltration, respectively. Functional annotation of the output variant was performed using the SnpEff (v.4.3). The RNA-editing level was calculated as the ratio of the total number of reads aligned to the GluA2 R/Q editing site (chr3: 80706912) to the number of reads with T-to-C conversion at this site.
Statistical analysis
In the animal model experiments, one-way ANOVA followed by Bonferroni multiple comparisons test and/or two-tailed t-test were used for the statistical analysis. Statistical significance was set at p < 0.05. In the human experiments, the relationship between BMI, GM volume of the whole brain, body weight, and percentage of correct responses to task conditions (new, lure, and same) was analyzed using partial correlation analysis. Differences between mean brain activity and correct answer rate under three (new, lure, and same) task conditions were analyzed using one-way ANOVA.