Patients and specimens
A total of 16 pairs of GC tissues and the pair-matched non-tumoral gastric tissues were acquired from the first people's hospital of suqian. The written consent agreement was signed and approved by the Ethics Committee of the Affiliated Suqian first People's Hospital of Nanjing Medical University. All patients involved in the present study didn’t receive chemotherapy or radiotherapy before the surgery. 16 tissues were stored at -80℃ immediately after the surgery.
Cell culture
The human gastric epithelial cell line GES-1, and human gastric cancer cell lines MKN-45, MKN-28 were purchased from the American Type Culture Collection (MD, USA). The human gastric cancer cell lines NCl-N87, AGS, HGC-27 were purchased from Chinese Academy of Sciences Cell Bank (Shanghai, China). All cells were cultured in RPMI-1640 culture medium supplemented with 10% fetal bovine serum (FBS, Invitrogen, USA) at 37 °C with 5% CO2.
Plasmids construction and transfection
The full-length lncRNA HOXB-AS4 was cloned into pcDNA3.1 (Invitrogen, USA), and the lncRNA HOXB-AS4 plasmid and corresponding empty vector were transfected into GES-1 or AGS cells using Lipofectamine 3000 reagent (Invitrogen, USA). The lncRNA HOXB-AS4 siRNAs, SP1 siRNAs, PKP4 siRNAs were synthesized by Genscript Biotech (Nanjing, China). miR-130-5p mimics, miR-130-5p inhibitors and relative control were purchased from Ribo Bio (Guangzhou, China). All siRNAs, miRNA mimics, inhibitors, or HOXB-AS4 plasmid were transiently transfected to cells by using Lipofectamine 3000 for 24 h. The sequences of si-HOXB-AS4: AAGAGGACCACTCAGTTTAGG; si-SP1: AAGTGCAGCAGGATGGTTCTG; si-PKP4: GAGACCACAGCCACCACTATT.
RNA Extraction and quantitative Real-Time PCR (qRT-PCR)
Total RNA was extracted using either TRIzol Reagent (Invitrogen, USA) following the manufacturer's instructions. Then mRNAs were reverse transcribed using the PrimeScript RT kit (Takara, Japan). The cDNAs were then analyzed by qRT-PCR using a QuantiTect SYBR Green PCR Kit (Qiagen, Germany), gene-specific primers and a Rotor gene Q real-time PCR cycler (Qiagen, Germany). The reaction condition was as follows: 95 °C for 30 s, at 60 °C for 30 s, 45 cycles at 60 °C for 30 s. RNA was quantified by 2−ΔΔCT method. After qRT-PCR reactions, the cycle threshold (CT) data were normalized to the internal control (U6 snRNA or GAPDH). Primers used were as follows: HOXB-AS4-F: CTT GTG CTT TAC AAG GCG GC, HOXB-AS4-R: GAC CGG CCC CTA GGT TTA TC; miR-130a-5p-F: GCG CGG ATC CAG GCG GCA AAA GGA AGA GTG GTG, miR-130a-5p-R: CGG CGA ATT CCA CAA GCA CTG CAT ACA GAA GTA G; miR-140a-5p-F: CGG GAT CCG GTC CTC TGT TCG GTG GTG GCG; miR-140-5p-R: CGG AAT TCA ACC AGC AAG GGG ATG TCC CAA G; U6-F: GCT TCG GCA GCA CAT ATA CTA A, U6-R: AAC GCT TCA CGA ATT TGC GT; GAPDH-F: TGT GTC CGT CGT GGA TCT GA; GAPDH-R: CCT GCT TCA CCA CCT TCT TGA.
Western blot
Western blot assay was used to assess epithelial-mesenchymal transition (EMT)-related makers Vimentin, N-Cadherin, and E-Cadherin and PKP4 protein expression. Total protein from tumor tissues or cells was extracted by using RIPA lysis buffer plus PMSF (Beyotime, China). BCA assay kit (Santa Cruz, USA) was used to detect total protein concentration. Prepared protein samples were separated by using SDS-PAGE electrophoresis, and transferred into PVDF membranes and incubated with prepared antibodies. Finally, enhanced chemiluminescence (ECL, ThermoFisher, USA) was used to visualize the membrane. The protein band analysis was conducted with ImageJ software. Antibodies against Vimentin, N-Cadherin, E-Cadherin, and GAPDH were purchased from CST (MA, USA). Antibody against PKP4 was purchased from Abcam (Cambridge, USA).
Cell viability assay
The viability of GSE-1 and AGS cells was assessed using MTT. Briefly, cells were plated in the 96-well microplates at a density of 1 × 104 cells per well. After transfection with indicated time, the cells were incubated with MTT (0.5 mg/ml) at 37 °C for 3 h. Then the medium was removed, and 100 mM DMSO solution was added to dissolve the formazan crystals. The absorbance at 570 nm wavelength was detected using a microplate reader (Molecular Devices, Sunnyvale, USA).
Clone formation assay
The GSE-1 or AGS cells were digested and plated in a 6 cm culture dish at a density of 5× 103/well after indicated treatments. The cells were subjected to the normal culture condition at 37℃, 5% CO2 for 14 days. Then the cells in the dish were washed with PBS, and fixed with 3 mL methanol for 10 minutes. The cells were subjected to Giemsa dyeing for another 15 minutes. Then the cells were observed under a light microscope (Olympus, Japan), and the number of colonies was counted.
Cell migration and invasion assay
Cell migration and invasion were determined by transwell assay. GSE-1 and AGS cells were harvested and seeded to the upper transwell chamber at a density of 5 × 104 cells per well into an 8-mm pore transwell plate (Costar, USA) pre-treated with Matrigel (BD biosciences, USA) or not. Serum-free medium was added onto the upper chamber, and the culture medium containing 20% FBS was added into the lower chamber. Following 24 h incubation, the unmigrated or uninvaded cells were cleaned using a cotton swab and then fixed in 4% paraformaldehyde for 20 min and stained with hematoxylin. Images were taken, and the cell number was calculated.
Methylation-specific PCR (MSP)
Genomic DNA was extracted from the GC tissues and adjacent normal tissues by using the DNA extraction Kit (Qiagen, Germany) according to the manufacturer’s instruction. The purified DNA was then exposed to bisulfite treatment by using the EpiTect Bisulfite Kit (Qiagen, Germany). Then the MSP of bisulfite-transformed DNA was performed with a nested, two-stage PCR method followed with the detection of the PCR products by using agarose gel electrophoresis.
Chromatin immunoprecipitation (ChIP)
ChIP assays were performed with an EZ-ChIP Kit (Millipore, USA) according to the manufacturer’s instructions. Briefly, GES-1 and AGS cells were cross-linked with 1% formaldehyde for 10 min followed with glycine treatment. Cell lysates were then sonicated to generate chromatin fragments and then immunoprecipitated with SP1 antibody (CST, USA). IgG antibody (CST, USA) was used as the negative control. The DNA fragment was amplified by PCR. The HOXB-AS4 primer sequences are as follows: F: CTGAGTTTTCAGCCCTCCTG, R: AAGCTCCAATGAAGGGGTCT. The product was then analyzed by using agarose gel electrophoresis.
Fluorescence in situ hybridization (FISH)
To detect HOXB-AS4 expression, GSE-1 and AGS cells were fixed in 4% formaldehyde for 15 min at room temperature and then permeabilized with 70% ethanol. After rehydrated for 5 min at room temperature, the cells were incubated by using biotin-labeled HOXB-AS4 probe (Genepharma, Shanghai, China) at 37 °C for 8 h. Then the Alexa Fluor 647-conjugated secondary antibody (Abcam, USA) was used to detect the biotin-labeled HOXB-AS4.
Luciferase reporter assay
The wild-type or mutant 3’UTR of PKP4 and the full length of HOXB-AS4 were amplified and cloned into pGL3-basic vector (Promega, WI, USA) separately. The binding site of 3’UTR of PKP4 was mutated from UAU UAU GUU UUU UAA AAU GUG AG to TTT ATA GTA TTA AAT TTT GAG TG for miR-130a-5p, and the potential binding sites of HOXB-AS4 was mutated from AAAAGAGA to TTTTGTG for miR-130a-5p. Then, AGS cells were plated on a 24-well plate and co-transfected with wild-type or mutant luciferase plasmids and miR-23c mimic, miR-23c inhibitor or control miRNA. A Dual-Luciferase Reporter Assay System (Promega, WI, USA) was used to measure the luciferase activity. The relative luciferase activity of each sample was normalized to Renilla luciferase activity.
Tumor xenograft model
1 × 107 AGS cells were suspended in 200 μl PBS and subcutaneously injected into right flank of 4–6-week-old BALB/c nu/nu male mice (Charles River Lab, Beijing, China). The mice were recorded the tumor volume (volume = (length × width2)/2) every 3 days. Knockdown of miR-130a-5p was performed by using miR-130a-5p antagomir (Ribo Bio, Guangzhou, China) which was administrated by tail injection at the dosage of 80 mg/kg. Knockdown of HOXB-AS4 or PKP4 was performed by using the related knockdown lentivirus (GenePharma, Shanghai, China) by intra tumoral injection of 50 μL virus (4×107 IU/mL) after the tumor cells injection. After 15 days, the mice were sacrificed. The tumor tissues were subjected to western blot analysis, hematoxylin-eosin (H&E) staining and immunohistochemical (IHC) analysis. The animal experiments were approved by the Animal Care and Use Committee of the first people's hospital of suqian.
H&E and IHC analysis
For H&E staining, the prepared tumor tissue slices were dewaxed and hydrated. After washed by water, tumor tissue slices were stained in hematoxylin solution for 5 min. Next, after treated by 1% hydrochloric alcohol for 15s, the slices were washed with water. And then the slices were stained by eosin solution for 1 min. Finally, tissue slices were dehydrated, transparentized and sealed by neutral gum, observed under an optical microscope (Olympus, Tokyo, Japan). For IHC staining, the paraffin-embedded tumor sections were dewaxed and treated with 3% H2O2 to deactivate endogenous peroxidase. After blocking non-specific antigen binding with 5% BSA at 37 °C for 1 h, the sections were incubated with a specific primary antibody against PKP4 (1:100 dilution, Abcam, USA) at 4 °C overnight. After incubating with the corresponding secondary antibodies at 37 °C for 1 h, the sections were stained with diaminobenzidine and counterstained with hematoxylin. Representative images were taken using a light microscope (Olympus, Tokyo, Japan).
Kaplan-meier analysis
The overall survival data were derived from the online database Genomic Data Commons Data Portal (https://portal.gdc.cancer.gov/). Of the 110 GC samples, 108 samples showed high HOXB-AS4 expression, whereas 82 samples showed low HOXB-AS4 expression. The survival rates were analyzed by Kaplan-Meier curves. Then, the log-rank test was performed to evaluate the mean of the two groups.
Bioinformatics
The online database Starbase (http://starbase.sysu.edu.cn/) was used to predict possible miRNAs that may be sponged by HOXB-AS4. In addition, the online database miRCancer (http://mircancer.ecu.edu/) was used to predict the abnormal expression of miRNAs in gastric cancer. Then, the miRNAs that may be sponged by HOXB-AS4 in gastric cancer were screened through the intersection of the Starbase and miRCancer. The online databases miRDB (http://mirdb.org/) and Targetscan (http://www.targetscan.org/)were used to screen the potential targets of miR-130a-5p.
Statistical analysis
All data were shown as mean ± s.e.m. and experiments were carried out at least three times. GraphPad 6.0 version was adopted for statistical analyses. Student’s t-test was performed to evaluate the mean of the two groups and one-way ANOVA followed Tukey’s poc host was used to analyze significant differences among multiple groups. P < 0.05 was regarded as statistically significant.