Isolation of samples from the shoulder capsule
The Ethics Committee of our institute approved this study and informed consent was obtained from all the patients involved. Patients with limited ROM of the shoulder joint associated with degenerative RCT were included in the study (exclusion criteria: traumatic RCTs, rotator cuff retear, frozen shoulder without RCT, calcific tendinopathy, osteoarthritis, and rheumatoid arthritis). To conform to ethical standards, we did not collect shoulder capsule samples from patients with RCT who did not have limited ROM of the shoulder joint.
Sixteen patients (average age of 65.9; nine men and seven women), who underwent surgical treatment for RCT with limited ROM of the shoulder joint at our hospital over a two-year period starting in January 2019, were chosen for the study. Eight cases were DM (DM group) and eight were non-DM (control group). The DM group was defined as those with a preoperative HbA1c level of ≥ 6.5 [16]. The sample size was determined by power analysis based on data from the previous study using G*Power 3.1. A shoulder ROM of 40° may be sufficient to have clinical significance according to a similar study [6]. Preliminary sample size calculations indicated that a difference in shoulder ROM (anterior elevation: AE) of 40° in the two groups was detectable with a sample size of 16 participants (8 in each group) using a t-test (effect size = 1.33, α = 0.05, power = 0.81). Referring to the consensus recommendation [17] [18], limited ROM of the shoulder joint was defined as a restriction of active shoulder motion and ROM (AE<150°, external rotation: ER<40°) of the glenohumeral joint, with normal findings on radiographs (excluding arthritic changes in the glenohumeral joint and calcific tendinopathy). Patients with adhesive shoulder arthritis were excluded from the study to evaluate the association of AGEs with ROM limitation due to pain and immobilization associated with RCT. For ethical reasons, patients with no ROM limitation were also excluded. Tissue from the shoulder capsule was obtained intraoperatively, and the tissue specimens were excised by the same surgeon (Y. M.). The shoulder capsule tissue was harvested using basket forceps from a site medial to the subscapularis tendon and adjacent to the joint labrum, as previously described [6]. A portion of the harvested shoulder capsule tissues was fixed in formalin for tissue staining, and the remaining tissues were minced to a size of approximately 1 mm3 and cultured. The minced tissue was cultured in a monolayer on a 100 mm-diameter culture dish in Dulbecco's modified Eagle's medium (DMEM, HyClone, Logan, UT, USA) mixed with 10% fetal bovine serum (FBS, Cansera, Rexdale, Ontario, Canada), 100 U/mL penicillin, and 100 µg/mL streptomycin. Cultures were incubated at 37°C in a humidified atmosphere of 5% CO2/95% air and passaged for 1–2 weeks. Cells in passages 2 and 3 were used in this study.
Histological Examination
After 24 h, formalin-fixed tissues were dehydrated and embedded in paraffin wax. Five micrometer sections were mounted on slides. Hematoxylin and eosin (H&E) staining (Fig. 1) and immunostaining were performed (Fig. 2). For immunostaining, the cells were deparaffinized, dehydrated, and incubated overnight at 4°C with the primary antibodies anti-AGE (10 μg/mL, Abcam, Cambridge, UK) and anti-RAGE (10 μg/mL, Abcam). After overnight incubation, the sections were incubated with secondary antibodies (Histofine Simple Stain MAX Po; Nichirei Bioscience, Tokyo, Japan) at room temperature (25℃) for 1 h and counterstained with hematoxylin. Digital images of the slides were taken using BioZero BZ-8000 (Keyence, Osaka, Japan). The color deconvolution plugin of Image J (ver. 1.52), a public domain Java-based image processing software developed by the National Institutes of Health (NIH), was used to quantify the stained areas [19]. In brief, the color images were digitally separated into red, green, and blue images. Pixel subtraction was performed from the red image to the blue image; thereafter, the average pixel intensity of the subtracted image was calculated (Fig. 2a). The percentages of the AGEs and RAGE staining were calculated as the average of the four fields of view.
Cell viability (Cell proliferation assay)
Cell viability was measured with the water-soluble tetrazolium salt (WST) assay using the Cell Counting Kit-8 (Dojindo, Kumamoto, Japan), and 5,000 cells were seeded in each of the 96 wells and cultured in DMEM for 24 h. After incubation, 10 μL of WST was added to each well and incubated at 37°C for 4 h, after which soluble formazan was quantified in viable cells. Cell viability was evaluated by measuring the absorbance of the reduced formazan at 450 nm using the WST assay.
ROS expression
Fluorescence immunostaining was used to assess the effect of ROS on cells derived from the shoulder capsule. Based on previous reports [20], the ROS expression was detected using the Total ROS/Superoxide Detection Kit (Enzo Life Science, Farmingdale, NY, USA). Cells (5 × 104 cells/mL) were incubated with the oxidation-sensitive fluorescent probe dichloro-dihydro-fluorescein diacetate (DCFH-DA) at a final concentration of 10 μM for 60 min in the dark at 37°C. After incubation, the cells were washed with PBS and resuspended in trypsin. For quantification, the number of ROS-positive cells and diamidino-2-phenylindole (DAPI)-positive cells in the four fields of view (0.75 mm x 1.0 mm) of each slide were counted and the mean value was calculated.
Apoptosis rate
Two days after incubation, immunofluorescence staining was performed to compare the apoptosis rates of the cells. The rate of apoptosis was determined by terminal deoxynucleotidyl transferase dUTP nick end-labeling (TUNEL) staining using the APO-DIRECT kit (Phoenix Flow Systems, San Diego, CA, USA) according to the manufacturer's protocol. The ratio of green-stained nuclear fragments to DAPI-stained cells was calculated for each of the four fields of view.
Quantitative Real-time PCR
Cells were seeded in 12-well culture plates at a density of 1.0 x 105 cells/well and cultured in DMEM for 48 h. Total RNA was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's protocol. Oligo(deoxythymidine)-primed first-strand cDNA was synthesized using the High Capacity cDNA Transcription Kit (Applied Biosystems, Foster City, CA, USA). Quantitative real-time PCR was performed in a 20 mL reaction mixture using the SYBR Green Master Mix reagent (Applied Biosystems) on an ABI Prism 7500 sequence detection system (Applied Biosystems). The PCR conditions were as follows: one cycle at 95°C for 10 min, followed by 40 cycles at 95°C for 15 s, and 40 cycles at 60°C for 1 min.
The messenger RNA (mRNA) levels of type I collagen (COL1), type III collagen (COL3), RAGE, NOX1, NOX4, interleukin-6 (IL-6), and IL-1β were evaluated using the method described above. The primer sequences are listed in Table 1.
Table 1
Primers for Real-time PCR
Gene
|
Forward Primer (5' to 3')
|
Reverse Primer (5' to 3')
|
NOX1
|
GGTTTTACCGCTCCCAGCAGAA
|
CTTCCATGCTGAAGCCACGCTT
|
NOX4
|
GCCAGAGTATCACTACCTCCAC
|
CTCGGAGGTAAGCCAAGAGTGT
|
RAGE
|
CACCTTCTCCTGTAGCTTCAGC
|
AGGAGCTACTGCTCCACCTTCT
|
COL1
|
AGGAATTCGGCTTCGACGTT
|
GGTTCAGTTTGGGTTGCTTG
|
COL3
|
GGGAACAACTTGATGGTGCT
|
CCTCCTTCAACAGCTTCCTG
|
Nox4
|
AGTCAAACAGATGGGATA
|
TGTCCCATATGAGTTGTT
|
IL6
|
AGACAGCCACTCACCTCTTCAG
|
TTCTGCCAGTGCCTCTTTGCTG
|
IL1β
|
TACGAATCTCCGACCACCACTACAG
|
TGGAGGTGGAGAGCTTTCAGTTCATATG
|
GAPDH
|
GTCTCCTCTGACTTCAACAGCG
|
ACCACCCTGTTGCTGTAGCCAA
|
Primers used in this study.
Relative gene expression levels were calculated using the DD-Ct method, with GAPDH as a reference. The expression of each gene was compared between the control and DM groups.
Statistical Analysis
All data are expressed as the mean ± standard deviation. Cell viability and real-time PCR results were expressed as n-fold differences from the baseline control at the corresponding time point. Student’s t-test was conducted to compare the control group with the DM group. The relationship between the amount of AGEs and ROM was evaluated using Pearson’s correlation coefficient. Results with a p-value <0.05, were considered significant. The data were analyzed using SPSS v23.0 (IBM Corporation, Armonk, NY, USA).