Use of the Coding Region of Leptospira Sp. LigB&nbsp;C-terminus as a Marker for Diagnostics of Animal Leptospirosis

doi:10.21203/rs.3.rs-121022/v1

Download PDF

Research Article

Use of the Coding Region of Leptospira Sp. LigB C-terminus as a Marker for Diagnostics of Animal Leptospirosis

https://doi.org/10.21203/rs.3.rs-121022/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

The causal agent of leptospirosis, pathogenic strains of the genus Leptospira spp., has Outer Membrane Proteins (OMPs) on its surface which play a fundamental role in infection and pathogenesis. Studies on the genome showed that the LigB protein gene is conserved in different pathogenic species.

Methods

The aim of this work was to propose a new end point PCR based on the amplification of the LigB C-Terminal coding region (ligb-ct), never used before and conserved among pathogenic Leptospira spp.

Eighteen reference pathogenic, 2 intermediate and 2 no-pathogenic strains of Leptospira spp. were used. DNA from 10 other microorganism species were included in this study to determine the analytical specificity.

Results

We obtained 100% positivity for pathogenic Leptospira strains. We found no cross-reaction with intermediate and non-pathogenic strains or with other microorganisms, highlighting a high analytical specificity. Analytical sensitivity estimated on clinical samples was higher on serum than blood and urine (6-9 x 10² lept/ml and 6-9 x 10⁵and 6-9 x 10⁶leptospires/ml, respectively). Multiple sequence alignment of this region in positive Leptospira species confirmed a high degree of conservation, with only a few single nucleotide polymorphisms.

Conclusion

To the best of our knowledge, the LigB C-Terminal coding region has not been previously used for molecular diagnostic and could be used for early diagnosis of leptospirosis.

Infectious Diseases

ligB gene

Leptospirosis

end point PCR

diagnostic methods

infectious diseases

Leptospirosis is an antropozoonotic endemic disease worldwide, mainly in underveloped countries with high levels of poverty. It is caused by pathogenic strains of Leptospira spp., characterized by fever and multi-organ failure in humans and animals. In addition, reproductive problems such as abortion and infertility in production animals as a consequence of these infections, result in important economic losse [1, 2].

The taxonomy of the genus was first based on serology, which distinguished almost 300 serovars. According to a more recent characterization using genetic molecular taxonomy, at least 64 species divided into 2 phylogenetic clades (P and S) and 4 subclades (P1, P2, S1 and S2) were described [3].

The pathogen has a variety of Outer Membrane Proteins (OMPs), such as LigA and LigB lipoproteins, on its surface, which mediate interaction with host extracellular matrix proteins, allowing the bacteria to colonize multiple host organs [4, 5].

LigA and LigB belong to the superfamily of bacterial immunoglobulin-like (Big) repeat domain proteins, shared with adhesins of other bacteria, such as intimin and invasin from enteropathogenic E. coli and Yersinia spp., respectively [6, 7].

Exposure to physiological osmolarity induces leptospires to express high levels of the Lig surface proteins and increases adhesion between leptospires and the host extracellular matrix and plasma proteins, such as collagens, laminin, fibronectin and fibrinogen [8]. Unlike LigA, LigB contains 12 Big domains followed by a long carboxy-terminal region, exposed to the extracellular medium and its are expressed early in the course of infection [9].

Lig genes are highly conserved (70–99% identity) among pathogenic species and virulent pathogenic leptospiral isolates [10, 11], however, the ligB gene is present in all pathogenic leptospira, while the ligA gene is only found in L. interrogans and L. kirschneri strains, and both are absent in intermediate or saprophyte Leptospira spp. species [12, 13].

Despite its relevance, leptospirosis is one of the most under-diagnosed zoonotic diseases. The Micro Agglutination Test (MAT) is considered the gold standard and is the most used tool for serological diagnosis. However, it presents certain inconveniences such as the requirement of paired samples with intervals of 15–21 days to have a confirmatory result, and lack of detection in the acute phase of the disease due to the absence of detectable antibodies in blood [1].

As a complement to MAT, PCR has been lately used for the molecular detection of pathogenic Leptospira DNA using different target genes such as secY and flab [14], ompL1 [15], lipL32 [16, 17], and ligB [|18,19]. However, few of the described PCR tests were subjected to rigorous validation analysis in the human and veterinary areas.

The aim of this work was to propose a new end point PCR based on the amplification of the LigB C-Terminal coding region (ligb-ct) as a novel diagnostic tool for leptospirosis.

Methods

Samples

Twenty-two reference Leptospira spp. strains were used in this study, 18 of which were pathogenic, 2 non-pathogenic and 2 intermediate (Table 1). Four strains were isolated from clinical samples from dogs (serovar Canicola strain Hond Utrecht IV), bovines (serovar strain Pomona), and 2 from rodents (serovar Copenhageni strain M20 and serovar Fiocruz strain L1-130), from Argentina. Environmental samples were isolated from water from the Argentine localities of Puerto Iguazú, Misiones province (1 sample), and Añatuya, Santiago del Estero province (3 samples). Water was pre-filtered through Whatman filter paper before filtration through 0.22 milipore size membranes. An aliquot (1 ml) of each filtered sample was inoculated in Fletcher medium supplemented with 5-Fluorouracil and Neomycin.

Table 1

Amplification of *Leptospira* spp. reference strains DNA by LigBct and LipL32 PCR protocols.
Group	Leptospira spp. reference strain	LigBct	LipL32
P	1-L.interrogans serovar Australis strain Ballico	+	+
P	2-L.interrogans serovar Bataviae strain Swart	+	+
P	3-L.interrogans serovar Canicola strain Hond Utrecht IV	+	+
P	4-L.interrogans serovar Djasiman strain Djasiman	+	+
P	5- L.interrogans serovar Icterohaemorrhagiae strain RGA	+	+
P	6- L.interrogans serovar Manhao strain Manhao	+	+
P	7- L.interrogans serovar Pomona strain Pomona	+	+
P	8- L.interrogans serovar Pyrogenes strain Salinem	+	+
P	9- L.interrogans serovar Wolffi strain 3705	+	+
P	10-L.interrogans serovar Bataviae strain Bit	+	+
P	11-L.interrogans serovar Bataviae strain Swart	+	+
P	12-L.interrogans serovar Hardjo strain Hardjoprajitno	+	+
P	13-L.interrogans serovar Copenhageni strain Fiocruz L1-130	+	+
P	14-L.borgpetersenii serovar Castellonis strain Castellon III	+	+
P	15-L.borgpetersenii serovar Hardjobovis strain Sponselee	+	+
P	16-L.weilii serovar Celledoni strain Celledoni	+	+
P	17-L.kirschneri serovar Grippotyphosa strain Moskva V	+	+
P	18-L.noguchi serovar Lousiana strain LSU 1945	+	+
NP	19-L.biflexa Andamana strain CH-11	-	-
NP	20-L.biflexa serovar Patoc strain Patoc I	-	-
I	21-L.fainei serovar Hurstbridge strain But6	-	-
I	22-L.licerasiae serovar Varillal strain Var010	-	-
+ and – correspond to positive and negative amplification, respectively, as verified by horizontal gel electrophoresis
P: pathogenic leptospiral strains. NP: non-pathogenic leptospiral strains. I: intermediate leptospiral strains

The Leptospira spp. reference strains, and environmental and clinical samples used are part of the collection of the Laboratory of leptospirosis, Reference Centre of the OIE (World Organization for Animal Health), Institute of Pathobiology, National Institute Agricultural Technology (INTA Castelar), Buenos Aires, Argentina.

DNA extraction

For DNA extraction, Leptospira sp. were grown for 7 days at 30 °C in EMJH medium, as described by Ellinghausen and McCollough [20], following the modifications of Johnson and Harris [21] and bacterial growth was monitored under a dark-field microscope.

Genomic DNA extraction was performed using 20 µl sample and 150 µl Chelex-100 (Bio-rad USA) as described Hamer et al. [22], and incubated at 56 °C during 20 min followed by 8 min at 100 °C. Samples were centrifuged at 10,000 rpm for 5 s and 20 µl of the supernatant were collected and stored at -20 °C until use.

The integrity of the extracted DNA was analyzed by electrophoresis in 1% agarose gels. DNA quantities were estimated by absorbance measurements in a Nanodrop spectrophotometer.

PCR amplification

Primers LigBct-Fw (ATGCCTTACTTTGGCGGC) and LigBct-Rv (AGGCTCCCAGTTGTGTGATG) were manually designed to amplify a 726 bp segment of the 3’ end of the LigB gene (ligBct), nt 5040 to 5764, based on the sequence of L. interrogans serovar Pomona (AF534640.1) (Fig. 1). Specificity of the primers was verified using Primer Blast.

The PCR amplification reaction was performed in a final volume of 50 µl using 5 µl purified DNA template (approximately 250 ng). The PCR mixture contained 1X buffer (500 mM KCl/100 mM Tris/HCl, pH 9.0), 3 mM MgCl₂, 0.5 µmol for each primer, 0.1 mM of each dNTP (Invitrogen, Carlsbad, CA, USA) and 1.25 U Taq polymerase (PBL, Buenos Aires, Argentina). The cycling program consisted on 3 min at 95 ºC, followed by 35 cycles of 30 sec at 95 °C, 30 sec at 60 °C and 2 min at 72 ºC, with a final extension period of 10 min at 72 °C. Amplification products were analyzed by electrophoresis in ethidium bromide-stained 2% agarose gels, using TAE Buffer, at 90 V during 60 min, followed by exposure to UV light. Amplicon sizes were estimated using a 100 bp ladder (PBL, Buenos Aires, Argentina).

The DNA integrity of negative samples was analyzed by LipL32 PCR followed by 1% agarose gel electrophoresis¹⁷.

Analytical specificity and sensitivity

The analytical specificity of the LigBct PCR was evaluated using 10 DNA samples from other pathogenic organisms that produce similar clinical signs and/or are commonly present in animal clinical samples: Brucella abortus, Campylobacter fetus fetus, Campylobacter fetus venearis, Neospora caninum, Infectious Bovine Rhinotracheitis Virus (IBRV-1 and 5), Bovine Viral Diarrhea Virus (BVDV), Mycobacterium spp., Escherichia spp., Borrelia spp. and Salmonella spp. Genomic DNA samples of these organisms were facilitated by researchers from the Center of Veterinary and Agronomic Research, INTA CICVyA, Argentina.

The analytical sensitivity was determined using serially diluted from L. interrogans serovar Pomona, in samples of bovine serum, blood and urine. The initial leptospiral concentration was adjusted by spectrophotometric measurements at 420 nm to approximately 6–9 × 10⁸ bacteria/ml (corresponding to OD₄₂₀ = 0.365).

Sequencing and alignment

After verification of the presence of amplicons by electrophoresis, 9 PCR products were purified and sequenced by Macrogen (Korea). The Clustal Omega program [23] was used to carry out a multiple sequence alignment to evaluate the degree of strain polymorphism. LigB C-terminal coding sequences were deposited in the GenBank under accession numbers MK976004 (L. interrogans serovar Pomona), MK976005 (L. borgpetersenii serovar Castellonis), MK976006 (L. interrogans serovar Canicola), MK976007 (L. interrogans serovar Copenhageni strain M20), MK976008 (L. interrogans serovar Hardjo), MK976009 (L. interrogans serovar Wolffi), MK976010 (L. interrogans serovar Pyrogenes), MK976011 (L. interrogans serovar Copenhageni strain Fiocruz L1-130), MK976012 (L. borgpetersenii serovar Hardjobovis)

The end point LigBct PCR was performed under the conditions mentioned in Materials and Methods. Amplification of a 700–800 bp fragment, compatible with the expected 726 bp fragment, was observed in all of the pathogenic Leptospira spp. species used in this study, while no amplification was obtained in intermediate and non-pathogenic leptospires (Fig. 2). Also, a single band was observed for all clinical and environment DNA samples used in this study. DNA integrity of negative samples was controlled by agarose gel electrophoresis and LipL32 gene PCR (Table 1).

We found no amplification when DNA samples of the following organisms were used as template: Brucella abortus, Campylobacter fetus fetus, Campylobacter fetus venearis, Neospora caninum. Infectious Bovine Rhinotracheitis Virus (IBRV-1 and 5), Bovine Viral Diarrhea Virus (BVDV), Mycobacterium spp., Escherichia spp., Borrelia spp., Salmonella spp. (not shown). This indicates a high analytical specificity of LigBct PCR for pathogenic Leptospira spp.

Analytical sensitivity analysis showed significant differences in a controlled assay in which bovine serum, blood, and urine were experimentally infected with serial dilutions of a L. interrogans serovar Pomona suspension. After DNA extraction and LigBct PCR, detection limits for serum, blood and urine were 6–9 × 10², 6–9 × 10⁵ and 6–9 × 10⁶ leptospires/ml, respectively.

Multiple sequence alignment of the amplified LigB C-terminus coding region was performed for 9 pathogenic leptospires belonging to L. interrogans serovar Pomona, L. interrogans serovar Canicola, L. interrogans serovar Copenhageni (strain M20), L. interrogans serovar Wolffi, L. interrogans serovar Hardjo, L. interrogans serovar Pyrogenes, L. interrogans serovar Copenhageni (strain Fiocruz L1-130), L. borgpetersenii serovar Castellonis, L. borgpetersenii serovar Hardjobovis. SNPs were observed at 17 positions. More than one possible nucleotide was observed at some of these positions when two samples of the same serovar were analyzed (Table 2).

Table 2

SNPs detected in the LigB-C Terminal coding region after multiple sequence alignment.
	Serovar Position	Pomona	Canicola	Copenhageni (M20)	Hardjo	Pyrogenes
SNP1	5	C	-	-	C/T	C/T
SNP2	8	T	-	T/A	-	-
SNP3	16	A	-	A/G	-	-
SNP4	17	G	-	-	G/A	-
SNP5	19	A	-	-	A/T	A/T
SNP6	26	A	-	A/C	-	-
SNP7	185	A	-	A/G	A/G	A/G
SNP8	186	A	-	A/G	A/G	A/G
SNP9	188	T	-	T/G	-	-
SNP10	203	A	-	A/G	A/G	A/G
SNP11	234	G	-	-	-	G/A
SNP12	385	A	A/C	A/C	A/C	A/C
SNP13	418	G	-	-	G/A	G/A
SNP14	504	C	-	-	C/T	C/T
SNP15	535	G	-	G/A	G/A	G/A
SNP16	565	C	-	C/A	C/A	C/G
SNP17	672	T	-	-	T/G	-

Leptospirosis remains a significant public health problem in many countries. Initially, the diagnosis of leptospirosis was based on the isolation of leptospires from clinical samples or the demonstration of seroconversion in serum samples [24]. Although these tools are still used, molecular methods based on DNA amplification such as PCR, also play an important role for diagnosis. PCR often proves to be superior to traditional methods for the detection of carrier and sick animals, due to its speed and high sensitivity and specificity [25, 26].

The first end point PCR to amplify Leptospira sp. DNA was developed by Gravekamp in 1993 using the secY and flaB genes of pathogenic leptospires as targets and was applied to blood samples [14]. Although this PCR was reported not to amplifiy the secY sequence of non-pathogenic species, Palaniappan amplified DNA from the non-pathogen L. biflexa, which could lead to false positive results in clinical samples [19].

The LipL32 protein gene is also widely used as target for diagnosis of leptospirosis in clinical samples. A Taqman qPCR developed by Stoddard [16] based on this gene can detect 10¹ leptospires/ml blood and 10³ leptospires/ml serum, while a qPCR developed by Levett¹⁷ has an analytical sensitivity of 3 genome equivalents per reaction and approximately 10 genome equivalents in human urine.

Studies of the genome of the Leptospira genus showed that the lipL32 gene is present not only in all species belonging to the pathogenic group, but also in recently described low-virulence species such as the intermediate group [27, 28, 12].

The ligB gene has also been used as PCR target. In 2017, Benacer et al [29] developed a duplex PCR targeting the 16S ribosomal RNA subunit gene (rrs) and different regions of the ligB gene. This assay detects pathogenic species DNA with a sensitivity of 10³ leptospires/ml of urine or water. Ali et al. [30] also worked with the ligB gene and developed a Loop Mediated Isothermal Amplification (LAMP) protocol, using six pairs of primers targetting a segment from nt 72 to nt 290. This LigB-LAMP assay was applied to urine samples from cattle and dogs and proved to be highly sensitive, detecting a minimum of 150 fg DNA. However, the cost of reagents for LAMP is higher than that of PCR, making LAMP more difficult to implement in some diagnostic laboratories. In 2018, Martinez et al. [18] proposed a typing tool based on the amplification of a 1044 bp fragment of the ligB gene, from 1158 nt to 2203 nt, which could discriminate some serovars.

In the present work, the LigB-C terminal coding region (ligb-ct) is used for the first time as PCR target, and proves useful for the diagnosis of animal leptospirosis. No cross-reaction with other microorganisms commonly found in clinical laboratory samples was observed, and no amplification was obtained with intermediate Leptospira species. This indicates that this tool is highly specific for pathogenic Leptospira species.

The sensitivity of the LigBct PCR was higher for serum samples than for blood and urine samples. This could be because anticoagulants used in blood extraction can act as PCR inhibitors affecting the efficiency of PCR when a commercial extraction kit is not used [31].

Importantly, since serum samples are used in the MAT gold standard, LigBct PCR could be a complementary tool to detect traces of leptospiral DNA in this type of samples when there are positive cases with low antibody titers. In addition, the successful amplification of various species of pathogenic leptospires achieved, as shown in Table 1, indicates that the primers recognize conserved regions and can be used for diagnosis.

Multiple sequence alignment of the LigB C-terminus coding region of 9 strains of pathogenic leptospires showed the presence of 17 single nucleotide polymorphisms (SNPs) (Table 2). Since different nucleotides were observed at some of these polymorphic sites when two or more samples of the same serovar were analyzed, these SNPs cannot be used as a genotyping tool. The observed polymorphism within one serovar in the 3’ LigB-C terminal coding region may be due to the fact that the encoded protein segment is extracellular and exposed to the selection pressure of the host immune system, thus this region is not a marker of neutral selection.

We showed that the ligBct PCR could successfully amplify DNA of environmental samples, after isolating and cultivating leptospires under laboratory conditions. Future studies will be devoted to test whether this assay can be applied to amplify Leptospira spp. DNA from raw water samples without cross-reaction with other microorganisms present in the sample and not tested in the present work.

The analytical specificity and analytical sensitivity of a diagnostic PCR is given by the success of amplification on the pool of samples used. The results of this PCR targeting the 3’ region of the LigB-C terminal coding region are encouraging for the detection of leptospiral DNA in clinical samples in the initial phase of leptospirosis. LigBct PCR could be applied as a screening tool when a leptospire infection is suspected, or as a prophylaxis tool for early control in areas where there is a history of leptospirosis clinical cases. This PCR could also be a useful complement to MAT, the reference method worldwide, as it showed high sensitivity in bovine serum samples.

OMPs

Outer Membrane Proteins.

Big

Bacterial Immunoglobulin-like.

MAT

Micro Agglutination Test.

ligb-ct

LigB C-Terminal coding region.

IBRV

Infectious Bovine Rhinotracheitis Virus.

BVDV

Bovine Viral Diarrhea Virus.

SNPs

Single Nucleotide Polymorphisms.

Ethics approval and consent to participate

Not applicable.

Consent for publication
Not applicable.

Availability of data and materials
All relevant data are within the paper and its Supporting Information files

Competing interests
The authors declare that they have no competing interests.

Funding
National Institute of Agricultural Technology (INTA) National Animal Health Program 1115052. Vanina Saraullo has a CONICET Doctoral Scholarship

Authors contribution
VS conducted the molecular detection, sampling collection, data analysis, wrote the first draft, revisión and final manuscript. SGL, OW, MH, MM and BB contributed to study design and revisions. MFC contributed to revision, edition an drafted the manuscript.
All authors read and approved the final manuscript.

Acknowledgements
Not applicable.

Author information
Not applicable

Corresponding author
Saraullo Vanina. [email protected]. Nicolas Repetto y Los Reseros s/n. Hurlingham, Buenos Aires. Argentina. Tel/Fax: +54(011)4621-1289. Int 3204.

Adler B., de la Pena Moctezuma, A. Leptospira and leptospirosis. Veterinary Microbiology. 2001;140:287-96.
Levett P. N. leptospirosis. Clin Microbiol. 2001;14:296–326.
Vincent AT, Schiettekatte O, Goarant C, Neela VK, Bernet E, Thibeaux R et al. Revisiting the taxonomy and evolution of pathogenicity of the genus Leptospira through the prism of genomics. PLoS neglected tropical diseases. 2019 13(5), e0007270.
Palaniappan RU, Chang YF, Jusuf SS, Artiushin S, Timoney JF, McDonough SP et al. Cloning and molecular characterization of an immunogenic LigA protein of Leptospira interrogans. Infect Immun. 2002;70:5924-30.
Raja V, Natarajaseenivasan K. Pathogenic, diagnostic and vaccine potential of leptospiral outer membrane proteins (OMPs). Crit Rev Microbiol. 2015;41:1-17.
Isberg RR, Voorhis DL, Falkow S. Identiﬁcation of invasin: a protein that allows enteric bacteria to penetrate cultured mammalian cells. Cell. 1987;50:769-78.
Jerse AE, Yu J, Tall BD, Kaper JB. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci. 1990;87:7839-43.
Choy HA, Kelley MM, Chen TL, Moller AK, Matsunaga J, Haake DA. Physiological osmotic induction of Leptospira interrogans adhesion: LigA and LigB bind extracellular matrix proteins and ﬁ Infect Immun. 2007;75:2441-50.
Matsunaga J, Barocchi MA, Croda J, Young TA, Sanchez Y, Siqueira I et al. Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily. Mol Microbiol. 2003;49:929-45
McBride AJA, Cerqueira GM, Suchard MA, Moreira AN, Zuerner RL, Reis MG, Haake DA et al. Genetic diversity of the leptospiral immunoglobulin-like (Lig) genes in pathogenic LeptospiraInfect Genet Evol. 2009;pp:196–205.
Croda J, Figueira CP, Wunder EA Jr, Santos CS, Reis MG, Ko AI et al. Targeted mutagenesis in pathogenic Leptospira: disruption of the ligB gene does not affect virulence in animal models of leptospirosis. Infect Immun. 2008; 76:5826-33.
Picardeau M. Virulence of the zoonotic agent of leptospirosis: still terra incognita? Nat Rev Microbiol.2017;15:297-307.
Cerqueira GM, McBride AJ, Picardeau M, Ribeiro SG, Moreira AN, Morel et al. Distribution of the leptospiral immunoglobulin-like (lig) genes in pathogenic Leptospira species and application of ligB to typing leptospiral isolates. J Med Microbiol.2009;58:1173-81.
Gravekamp C, Van de Kemp H, Carrington D, Schoone G, Everard C, Hartskeerl R, et al. Detection of seven species of pathogenic leptospires by PCR using two sets of primers. J Gen Microbiol.1993;139:1691-700.
Raven E. Reitstetter. Development of species-specific PCR primer sets for the detection of FEMS Microbiol Lett.2006;264:31-9.
Stoddard RA, Gee JE, Wilkins PP, McCaustland K, Hoffmaster AR.. Detection of pathogenic Leptospira spp. through Taq Man polymerase chain reaction targeting the LipL32 gene. Diagn Microbiol Infect Dis. 2009;64:247-55.
Levett PN, Morey RE, Galloway RL, Turner DE, Steigerwalt AG, Mayer LW. Detection of pathogenic leptospiras by real-time quantitative PCR. Journal of Med Microbiology. 2005;54:45-49.
Martinez M, Grune S, Romero G, Brihuega B. Diferenciación de serovares de leptospiras patógenas mediante PCR del gen LigB y secuenciación. Rev Argent Microbiol. 2018;50:126-130.
Palaniappan RU, Chang YF, Chang CF, Pan MJ, Yang CW, Harpending P et al. Evaluation of lig-based conventional and real time PCR for the detection of pathogenic leptospires. Mol Cell Probes. 2005;19:111-7.
Ellinghausen HC Jr, McCullough WG. Nutrition of Leptospira Pomona and Growth of 13 Other Serotypes: Fractionation of Oleic Albumin Complex and a Medium of Bovine Albumin and Polysorbate 80. Am J Vet Res. 1965;26:45–51.
Johnson RC, Harris VG. Differentiation of pathogenic and saprophytic letospires. Growth at low temperatures. J Bacteriol. 1967;94:27–31.
Hamer M, Saraullo V, Brihuega B, Watanabe O, Martinez M, Grune Loffler S. Comparación de métodos de extracción de ADN simples y económicos para el diagnóstico molecular de leptospirosis animal. 2019;18:68–73.
Sievers F, Higgins DG. Clustal Omega, accurate alignment of very large numbers of sequences. Methods Mol Biol. 2014;1079:105-116.
Speelman P. Leptospirosis. In: Kasper DL, Braunwald E, Fauci AS, Hauser SL, Longo DL, Jameson JL, editors. Harrison`s Principles of Internal Medicine. 16th ed, New York: McGraw Hill. 2005;pp 988-990.
Harkin KR, Roshto YM, Sullivan JT. Clinical application of a polymerase chain reaction assay for diagnosis of leptospirosis in dogs. J Am Vet Med Assoc. 2003;222:1224-9
Lilenbaum W, Varges R, Ristow P, Cortez A, Souza SO, Richtzenhain LJ et al. Identification of Leptospira spp. carriers among seroreactive goats and sheep by polymerase chain reaction. Res Vet Sci. 2009;87:16-9.
Kumaran SK, Bakar MFA, Mohd Padil H, Mat-Sharani S, Sakinah S, Poorani K et al. 3D modelling of the pathogenic Leptospira protein LipL32: A bioinformatics approach. Acta Tropica. 2017;176:433-39.
Thibeaux R, Girault D, Bierque E, Soupé Gilbert ME, Rettinger A, Douyére A et al. Biodiversity of environmental Leptospira: improving identification and revisiting the diagnosis. Front Microbiol. 2018;1:816-19.
Benacer D, Zain SNM, Lewis JW, Khalid MKNM, Thong KL. A duplexendpoint PCR assay for rapid detection and differentiation of Leptospira strains. Rev Soc Bras Med Trop. 2017;50:239-42.
Ali SA, Kaur G, Boby N, Sabarinath T, Solank i K, Pal D et al. Rapid and visual detection of Leptospira in urine by LigB-LAMP assay with pre-addition of dye. Mol Cell Probes. 2017;36:29-35.
Wilson IG. Inhibition and facilitation of Nucleic Acid Amplification. Appl Environ Microbiol. 1997;63:3741-51.

Download PDF

Version 1

posted

You are reading this latest preprint version

Use of the Coding Region of Leptospira Sp. LigB C-terminus as a Marker for Diagnostics of Animal Leptospirosis

Status:

Version 1

Abstract

Figures

Background

Results

Discussion

Conclusion

Abbreviations

Declarations

References

Status:

Version 1