Total RNA extraction and cDNA synthesis
The total RNA extraction for collected samples was performed by using Direct-zol™ RNA MiniPrep Plus kit (Zymo Research, California, United States) following the manufacturer’s guidelines. Extracted RNA was first subjected to cDNA synthesis prior to conventional RT-PCR and qRT-PCR assays. cDNA synthesis was performed by using the SensiFAST™ cDNA Synthesis Kit (Bioline, London, UK) with 20 L reaction consisting of 10 L purified RNA, 4 L of 5x TransAmp Buffer, 1 L reverse transcriptase and 5 L nuclease-free water. The reaction was carried out at 25 for 10 mins, 42 for 15 mins, 48 for 15 mins and 85 for 5 mins. The cDNA was stored in -20 until use.
Taqman-based real-time RT-PCR (qRT-PCR) assay
Primer set and probe were designed based on partial N gene sequences of FeMV-Malaysia isolates (UPM23, UPM52, UPM53, UPM210, UPM231, UPM305 and UPM315) using Integrated DNA Technologies (IDT) software (Table 4). The designed probe and primer set were then compared with the alignment of closely-related FeMV from other countries’ isolates: Japan (SS3, MiJP003, ChJP073), China (M252A) and Thailand (Thai-U16) (Table 4). Specific sequences for primers and probe used were as follows to yield 122bp PCR amplicons: forward primer, GGTCAAGAGATGGTGAGAAGAT; reverse primer, CCAGATTCACCTCCCGAATTA; and probe, TTTGCGCGAGAACTTGGGCTATCT. The FeMV Taqman probe was labeled with 6-FAM at 5’-end, and fluorescence quencher, ZEN and IBFQ at an internal site and 3’-end, respectively. Real-time RT-PCR was performed using CFX96 machine (Bio-Rad, California, USA) utilizing SensiFASTTM Probe NO-ROX Kit (Bioline, London, UK) following the manufacturer’s suggestion. Briefly, each reaction well was consisted of 4 L cDNA, 10 L of 2x SensiFAST Probe No-ROX Mix, a final concentration of 400 nM for each forward and reverse FeMV primers, 100 nM probe and nuclease-free water up to the final volume of 20 L. The assay was performed at 95 for 2 mins, followed by 35 cycles of 95 for 15 secs and 54 for 45 secs and each sample was run in triplicates.
Table 4 GenBank accession number
Isolate
|
Accession Number
|
SS3
|
LC036587
|
MiJP003
|
AB924121
|
ChJP073
|
AB924122
|
M252A
|
JQ411016
|
Thai-U16
|
MF627832
|
UPM23
|
MN264638
|
UPM52
|
MN264639
|
UPM53
|
MN264640
|
UPM210
|
MN264641
|
UPM231
|
MN264642
|
UPM305
|
MN792827
|
UPM315
|
MN792828
|
Standard RNA preparation
Generation of standard RNA was prepared by sub-cloning the partial sequence of 1.5kb FeMV-N gene into a pSC-A-amp/kan plasmid vector by using StrataClone PCR cloning kit (Agilent Technologies, California, United States) according to the manufacturer’s instruction. After linearization, RNA transcription was performed using the Riboprobe® in vitro Transcription Systems (Promega, Wisconsin, United States) with the T7 RNA polymerase promoter site available in vector pSC-A-amp/kan following the manufacturer’s direction. After DNase treatment, the transcript was purified by phenol:chloroform purification and quantified by using spectrophotometer (Bio-Rad, California, USA). The copy number of cRNA calculated was 1.74 x 1011 copies/L. cRNA was diluted in 10-fold serial dilution and converted to cDNA prior to standard curve generation.
Specificity and sensitivity
The specificity of the developed assay was assessed by testing on viral RNA from same genus, which were canine distemper virus (CDV) and measles virus (MeV), from same family, Newcastle disease virus (NDV), and from other feline viruses, which were feline leukemia virus (FeLV) and feline coronavirus (FCoV) (Table 5).
The sensitivity of qRT-PCR assay was assessed by running 10-fold serial dilution of cRNA standard (1.74 x 1011 to 1.74 x 102 copies/L) to detect the threshold limit of the assay. Ten different 10-fold serial dilution was performed by adding 1 L of RNA into 9 L of nuclease-free water. The mixture was then vortexed for at least 10 secs before the same step was repeated for the next dilution. Each of the diluted RNA along with the stock RNA control was converted into cDNA and subjected for qRT-PCR in triplicates.
Table 5 List of viruses used in this study and its sources
Virus
|
Sources
|
Canine distemper virus (CDV)
|
Nobivac Puppy DP, Intervet
|
Measles virus (MeV)
|
Serum Institute of India LTD, Pune
|
Newcastle disease virus (NDV)
|
Department of Vet. Pathology and Microbiology, UPM
|
Feline leukemia virus (FeLV)
|
Department of Vet. Pathology and Microbiology, UPM
|
Feline coronavirus (FCoV)
|
Department of Vet. Pathology and Microbiology, UPM
|
Reproducibility
In order to assess reproducibility of the developed assay, three different positive samples were selected which were then subjected for intra- and inter-assay. Three different positive samples (UPM23, UPM52, UPM202) were assayed in the same run in triplicates to evaluate the intra-assay variations. In order to assess for inter-assay variations, the same three samples were subjected for three different consecutive runs in triplicates. Values for mean, standard deviation (SD) and coefficient of variations (CV) for both variation assays were calculated by using Microsoft Excel Software (version 2016, USA).
Clinical samples collection
Animal ethics application was approved by the Institutional Animal Care and Use Committee (IACUC) of Universiti Putra Malaysia (UPM/IACUC/AUP-R037/2018). Convenient sampling was performed whereby urine (n = 55) and kidney samples (n = 16) were collected from veterinary hospital, private veterinary clinics around Klang Valley, Malaysia and animal shelters. The cats presented to the veterinary hospital or private veterinary clinics were either presented for annual health examination, neutering procedure or having health-related issues, such as kidney-related and heart diseases. Cats’ samples which their serum urea-creatinine data were available were further sub-grouped into cats with presence or absence of kidney-related disease based on the International Renal Interest Society (IRIS) Guidelines. The owner’s consent was requested prior to samples collection. When available, kidney samples (n = 16) from post-mortem and corresponding urine samples (n = 16) were collected from animal shelters.
Sample processing
A urine sample was collected into a sterile sample collection bottle either by cystocentesis or manual compression. The supernatant of urine was obtained after a centrifugation step at 2320 x g for 5 mins. Then, the supernatant was mixed with RNAlater® solution (Ambion, Texas, United States) at ratio 1:1 and stored at -20 prior to RNA extraction. During postmortem, the collected kidney samples were immediately transferred into a sterile collection bottle containing RNAlater® solution. For sample processing, kidney tissues of approximately 1 g were cut into small pieces and crushed by using the pestle and mortar along with sterile sand. Phosphate-buffer saline solution (Gibco, Massachusetts, United States) of 1g/mL was added into the homogenized kidney. Then, the mixture was transferred into a 15 mL tube to be centrifuged at 2320 x g for 5 mins to remove any large debris and sand. The kidney lysate was then subjected for total RNA extraction.
Clinical samples evaluation using Taqman-based qRT-PCR and conventional RT-PCR
Converted cDNA clinical samples were assessed by conventional RT-PCR using published primers (Table 6) with cDNA of UPM52 as a positive control together with no-template control following a modified protocol (Table 7).
Taqman-based qRT-PCR was performed according to the developed protocol described above with each sample ran in triplicates along with NTC and cDNA of positive control (UPM52). Nuclease-free water (Promega, Wisconsin, United States) was used as the template in NTC in both conventional RT-PCR and qRT-PCR assays.
Table 6 Primer sequences used to amplify two different regions of N gene
Region
|
Primer
|
Sequence (5’-3’)
|
Product size (bp)
|
Source
|
Middle region
|
FN-2F
|
GTTAGCTTAGGATTTGAGAACCC
|
680bp
|
[9]
|
FN-2R
|
CACCATCTCTTGACCAAGTCT
|
End region
|
FN-3F
|
GCTATGGAGTTATGCCATGGG
|
637bp
|
FN-3R
|
GTTGTGAACCTTGAGGTCCTAAG
|
Table 7 PCR protocol applied for two different primer sets of N gene
Step
|
Temperature
|
Time
|
Cycle
|
Initial denaturation
|
95
|
1 min
|
1x
|
Denaturation
Annealing
|
95
58
72
|
15 secs
1 min
|
35x
|
Extension
|
1 min
|
|
Final extension
|
72
|
5 mins
|
1x
|
Hold
|
12
|
|
1x
|
Platynosomum sp. detection from postmortem of shelter cats
Liver, bile duct and faeces samples in rectum were collected in the postmortem investigation of shelter cats to detect the presence of Platynosomum sp. Liver samples were used to collect adult fluke while bile duct and faeces samples were used to detect ova. In order to allow for activation and collection of mature flukes, liver samples were extracted and immersed in warm water (38-40). Parasitic burden was calculated using the formula described in a previous study by applying the number of adult flukes collected per samples [22]. For ova collection from bile juice and faeces samples, any ova isolated from these clinical samples were pipetted into microcentrifuge tubes with normal saline and they were stored in -20 for further analysis. In faecal examination, two different methods were performed to detect fluke eggs: the simple floatation technique and centrifugal faecal sedimentation test in formal-ether solution [23, 24]. Adult fluke and ova were identified based on a previous study [25].