Novel mutations identified in the Chinese Han population with keratoconus by next-generation sequencing

doi:10.21203/rs.3.rs-121907/v1

Download PDF

Research article

Novel mutations identified in the Chinese Han population with keratoconus by next-generation sequencing

https://doi.org/10.21203/rs.3.rs-121907/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 10 Feb, 2022

Read the published version in Journal of Ophthalmology →

Version 1

posted

You are reading this latest preprint version

BACKGROUND

Keratoconus (KC) is characterized by bilateral progressive corneal thinning and ectasia. The prevalence of KC is approximately 8.8 to 54.4 per 100,000 individuals across the globe. Genetic factors have been shown to contribute to the pathogenesis of KC. This study will identify new mutations in the susceptibility gene of keratoconus (KC) in the Chinese Han population.

METHODS

A total of fifty-two patients with primary KC were recruited. Blood samples were collected, and genomic DNA was isolated from peripheral blood leukocytes. The entire coding region, intron–exon junctions, and promoter regions of sixteen known KC susceptibility genes were screened with next-generation sequencing technology, and all identified variants were further confirmed using the Sanger sequencing technology. The Sorting Intolerant from Tolerant (SIFT), Mutation Taster and PolyPhen 2 programs were used to predict the effect of amino acid substitution on protein.

RESULTS

After removing twelve known SNPs (single nucleotide polymorphisms) and three variants predicted to be harmless, nine novel mutations were identified in eight of the fifty-two patients, including c.455C > T:p.P152L in FNDC3B, c.3636_3637del:p.R1212fs in COL4A4, c.5015G > T:p.R1672L, c.3798dupA:p.P1267fs and c.28G > A:p.A10T in MPDZ, c.1940C > T:p.P647L in DOCK9, c.127_128insGGC:p.Q43delinsRQ in POLG, c.3019G > A:p.V1007I in IPO5, and c.624 + 7->A in TGFBI. All nine mutations in the patients with KC were heterozygote.

CONCLUSION

This study enlarged the gene profile of KC and should be further confirmed by well-powered, genome-wide association studies (GWAS) of Han Chinese patients.

Ophthalmology

Cornea

TGFBI

COL4A4

genome-wide association studies

type IV collagen family

Keratoconus (KC) is characterized by bilateral progressive corneal thinning and ectasia [1]. It typically begins in adolescence and progresses until the fourth decade of life[2]. KC is one of the most common causes for keratoplasty in the developed world[3]. According to epidemiologic studies, the prevalence of KC is approximately 8.8 to 54.4 per 100,000 individuals across the globe, depending on the diagnostic criteria of KC and population characteristics [3].

Despite the high prevalence of KC, the etiology of the disease is not well understood. Given the fact that KC is an irreversible disease, it is vital to identify patients with risk factors as soon as possible. Many studies have been performed to identify risk factors related to KC[4–7].

Genetic factors have been shown to contribute to the pathogenesis of KC, although the pathogenesis of many risk genes have yet to be determined [4]. Genome-wide association studies (GWAS) and candidate gene association studies have identified over 150 polymorphisms in more than 60 genes related to increased susceptibility to KC [8]. However, few studies have been conducted in Han Chinese patients with KC. To enlarge the genetic profile of KC in the Han population, this study was designed to screen the coding regions of NFIB(nuclear factor I B), LIG3༈DNA ligase 3༉, XRCC1༈X-ray repair cross complementing 1༉, TF༈transferrin༉, ZEB1༈zinc finger E-box binding homeobox 1༉, NEIL1༈nei like DNA glycosylase 1༉, FNDC3B༈fibronectin type III domain containing 3B༉, COL4A4༈collagen type IV alpha 4 chain༉, MPDZ༈multiple PDZ domain crumbs cell polarity complex component༉, DOCK9༈dedicator of cytokinesis 9༉, TGFBI༈transforming growth factor beta induced༉, PARP1(poly(ADP-ribose) polymerase 1), POLG(DNA polymerase gamma), IPO5(importin 5),FASLG༈Fas ligand ༉and IL1B(interleukin 1 beta)genes in the Chinese population.

Thirty male and twenty-two female KC patients,aging from eleven to forty-three years, were willing to enroll in this study, which, to the best of the authors’ knowledge, was a random sub-set of the total eligible population. All KC patients included in the study had negative family histories for KC. KC is diagnosed by experienced ophthalmologists. The diagnosis is based on clinical manifestations like corneal stromal thinning, Vogt’s striae, Fleischer ring, Munson’s sign, conical protrusion of the cornea at the apex, an anterior corneal stromal scar using a slit-lamp microscope, etc.(localized, increased surface power, and/or inferior-superior dioptric asymmetry [Bausch & Lomb Surgical, Orbtek Inc., Salt Lake City, UT]). Any patient with a coexisting allergy; atopy KC secondary to such causes as trauma; or with osteogenesis imperfecta, or pellucid marginal degeneration, Down syndrome, Ehlers-Danlos syndrome was excluded from this research.

As we previously described the method of sample collection and sequencing [3], blood samples (five ml) of the participants contained in Vacutainer tubes (Becton-Dickinson, Franklin Lakes, NJ) containing ethylene diamine tetra acetic acid is stored at -80 °C. These samples are then used to extract genomic DNA using the Simgen DNA Blood Mini Kit (Simgen, Hangzhou, China) according to the manufacturer’s instructions. For KC patients, all sixteen genes including NFIB, LIG3, XRCC1, TF, ZEB1, NEIL1, FNDC3B, DOCK9, COL4A4, POLG, MPDZ, IPO5, TGFBI, PARP1, FASLG, and IL1B were screened with next-generation sequencing technology and compared commercial databases with Sanger sequencing to determine that mutations are meaningful and important.

All coding regions (exons, intron–exon junctions, and promoter regions) of the sixteen genes were amplified with PCR using specific primer sequences. Three different amplification conditions are as mentioned before [3]. The PCR products were isolated with electrophoresis and sequenced using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) on an Applied Biosystems ABI 3730 Sequencer Analyzer. The PolyPhred version were used to compare sequences in GenBank database of the National Center for Biotechnology Information and analyze the sequencing results. The SIFT programs,Mutation Taster and PolyPhen 2 were used to predict the effect of mutations on protein. Both of the predicted scores were positively correlated with pathogenicity, and the significance level was set at 0.85. Only those that met the following criteria were recognized as harmful to the function of the protein: (i) SIFT score ≤ 0.05 and (ii) Mutation Taster or PolyPhen 2 score ≥ 0.85.

The entire coding region, intron–exon junctions, and promoter regions of NFIB, LIG3, XRCC1, TF, ZEB1, NEIL1, FNDC3B, DOCK9, COL4A4, POLG, MPDZ, IPO5, TGFBI, PARP1, FASLG, and IL1B genes were screened. Twenty-four variants were identified in fifty-two sporadic KC patients with next-generation sequencing technology. A total of twenty sequence variants were nonsynonymous single-nucleotide variants; two variants caused frameshift insertion; and two variants were located in the region of 2 bp around the splicing junction. These results are summarized in Table 1.

Table 1

.All variants identified in KC patients in the present study.
Gene	Nucleotide change	Amino acid change	SNP ID	Frequency (1 KG Project)	Gene region	Mutation effect	SIFT score	POLYPhen V2 Score	Mutation Taster
NFIB	c.196C > G	p.P66A	rs140030018	0.00219649	exonic	nonsynonymous	0.14	0.999
LIG3	c.1626G > T	p.K542N			exonic	nonsynonymous	0.06	0.573
XRCC1	c.1141G > A	p.V381M	rs2271980		exonic	nonsynonymous	0	0.977
TF	c.521C > T	p.S174L	rs150679929	0.00159744	exonic	nonsynonymous	0.03	0.678
ZEB1	c.2998G > C	p.E1000Q			exonic	nonsynonymous	0.08	0.293
NEIL1	c.833C > T	p.T278I	rs142213781	0.000599042	exonic	nonsynonymous	0	0.998
FNDC3B	c.455C > T	p.P152L			exonic	nonsynonymous	0	0.963	1
FNDC3B	c.1438G > A	p.A480T	rs201974179	0.000599042	exonic	nonsynonymous	0.15	0.17
COL4A4	c.3636_3637	del:p.R1212fs			exonic	frameshift deletion
MPDZ	c.5015G > T	p.R1672L			exonic	nonsynonymous	0
MPDZ	c.3798dupA	p.P1267fs			exonic	frameshift insertion
MPDZ	c.394G > A	p.G132S	rs201101621	0.000399361	exonic	nonsynonymous	0.03
MPDZ	c.28G > A	p.A10T			exonic	nonsynonymous	0.05
DOCK9	c.1940C > T	p.P647L			exonic	nonsynonymous	0
TGFBI	c.624 + 7->A				splicing
PARP1	c.2440A > G	p.I814V	rs200630156	0.000798722	exonic	nonsynonymous	0.21	0.151
PARP1	c.114G > A	p.M38I			exonic	nonsynonymous	0.09	0.646
PARP1	c.14C > G	p.S5W	rs201256399	0.00119808	exonic	nonsynonymous	0	0.299
POLG	c.3139C > T	p.R1047W	rs181860632	0.000399361	exonic	nonsynonymous	0.02	1
POLG	c.2890C > T	p.R964C	rs201477273	0.00299521	exonic	nonsynonymous	0	1
POLG	c.127_128insGGC	p.Q43delinsRQ			exonic	frameshift insertion
IPO5	c.3019G > A	p.V1007I			exonic	nonsynonymous	0.03	0.006	0.994
FASLG	c.280T > G	p.L94V	rs56302117	0.00259585	exonic	nonsynonymous	0	0.778
IL1B	c.275C > T	p.T92I	rs200401035	0.000199681	exonic	nonsynonymous	0.01	0.766

Table 1 .All variants identified in KC patients in the present study.

The following were excluded from the study: twelve known SNPs(single nucleotide polymorphism) (rs140030018, rs2271980, rs150679929, rs142213781, rs201974179, rs201101621, rs200630156, rs201256399, rs181860632, rs201477273, rs5602117, rs200401035) and three single nucleotide variants (LIG3, c.1626G > T; ZEB1, c.2998G > C; PARP1, c.114G > A), whose Sorting Intolerant from Tolerant (SIFT) score > 0.05 and Polyphen V2 (or Mutation Taster) score < 0.85. The following nine novel mutations were selected for further characterization with Sanger sequencing technology to avoid false-positive results: FNDC3B (c.455C > T:p.P152L), COL4A4 (c.3636_3637del:p.R1212fs), MPDZ (c.5015G > T:p.R1672L; c.3798dupA:p.P1267fs; c.28G > A:p.A10T), DOCK9(c.1940C > T:p.P647L), POLG(c.127_128insGGC:p.Q43delinsRQ), IPO5(c.3019G > A:p.V1007I), and TGFBI (c.624 + 7->A). The forward and reverse primers used in the direct Polymerase Chain Reaction(PCR) sequencing are summarized in Table 2. The results indicated that no mutation was identified as a false-positive result with the use of Sanger sequencing technology.

Table 2

Sequences of primers used in this study.
Gene	Mutations	Primer name	Fragment size (bp)	Primer sequence
FNDC3B	c.455C > T:p.P152L	6F	417	TGCGTTCTTTCCTTTTGTGTT
		6R		GCTAGGAATTCCCCATGAGTC
COL4A4	c.3636_3637del:p.R1212fs	7F	324	TCCTCATTGCATTTGGAAGGT
		7R		GCAACCAGTTGTTGGTGTCTG
MPDZ	c.5015G > T:p.R1672L	12F	484	GTTCCTTAGTGAGGGGGCTAA
		12R		AATGCCTGTTTTTGACCTTCA
MPDZ	c.3798dupA:p.P1267fs	9F	494	GAGACACAGAGTGGCTGATCC
		9R		ACAAACCCACTGCATTCTTTT
MPDZ	c.28G > A:p.A10T	13F	345	CCTGCTTGGGTGAATGATGTC
		13R		GGGTCCGGCCTACTGTTTTT
DOCK9	c.1940C > T:p.P647L	17F	353	CAAACCTTAAGGGGCTGAGAG
		17R		CCTGCAGTAAAACTCCCATCA
POLG	c.127_128insGGC:p.Q43delinsRQ	11F	425	CAGCTCCACGTCGGGCAAGG
		11R		GCCCAAAGCCAGGTGTTCTGACTCC
IPO5	c.3019G > A:p.V1007I	8F	445	CCCTCTGTTGCCATTCTGTAA
		8R		AGGAAGCACTGTGGAGGAGA
TGFBI	c.624 + 7->A	19F	402	CAGAGTTGCAAGGACCCATCT
		19R		GCAAAATGTGGGTTCCACAAG

The patient who carried mutation FNDC3B was also detected with mutation COL4A4 (c.3636_3637del:p.R1212fs). In addition, the patient with KC who carried mutation DOCK9 (c.1940C > T) was also detected with a ZNF469 mutation (c.3466G > A) (the results of ZNF469 have been published[9]). The SIFT score of the ZNF469 mutation was zero, which is considered to be damaging.

Sequencing chromatograms of the nine novel mutations in the seven genes are shown in Fig. 1. All identified mutations were located in the exonic region or the region of 2 bp around the splicing junction. According to SIFT and Polyphen V2 (or Mutation Taster) scores, none of the nine mutations was classified as tolerated (Table 1).

Figure 1.Sequence chromatogram of the nine novel mutations.

Table 3 shows the characteristics of the eight patients with KC carrying the nine novel mutations. All patients with KC were diagnosed with bilateral KC. The mean age of the eight patients was twenty-two years, and six patients were male. Central corneal thickness (CCT) was examined in the KC patients with videokeratography during their initial visit, and the mean values were 457 µm for OD(oculus dexter), and 454 µm for OS༈oculus sinister༉.

Table 3

The characteristics of 8 patients carrying the nine novel mutations.
Subject	Gene	Age range at detection	Gender	Eye	Keratoplasty	Central thinnest corneal thickness (OD/OS, µm)
1	FNDC3B	20–29	Female	OU	No	464/459
1	COL4A4	20–29	Female	OU	No	464/459
2	IPO5	10–19	Male	OU	No	457/479
3	MPDZ	20–29	Male	OU	No	405/370
4	POLG	20–29	Male	OU	No	459/458
5	MPDZ	10–19	Female	OU	No	426/456
6	MPDZ	30–39	Male	OU	No	532/518
7	DOCK9	10–19	Male	OU	No	414/386
7	ZNF469	10–19	Male	OU	No	414/386
8	TGFBI	20–29	Male	OU	No	502/506

In the present study, nine novel mutations were identified in FNDC3B (c.455C > T:p.P152L),COL4A4 ( c.3636_3637del:p.R1212fs),MPDZ (c.5015G > T:p.R1672L; c.3798dupA:p.P1267fs; c.28G > A:p.A10T), DOCK9 (c.1940C > T:p.P647L), POLG (c.127_128insGGC:p.Q43delinsRQ), IPO5 (c.3019G > A:p.V1007I), and TGFBI (c.624 + 7->A) in eight of the fifty-two patients with KC of Han Chinese ethnicity. The mutation in FNDC3B (c.455C > T:p.P152L) coexisted with the mutation in COL4A4 ( c.3636_3637del:p.R1212fs) in one female KC patient (Table 3), and the mutation DOCK9 (c.1940C > T:p.P647L) coexisted with a potentially damaging ZNF469( (c.3466G > A ) mutation in one male KC patient. All of the mutations were found in sporadic KC cases and were absent in the results of the whole-exome sequencing (WES) data acquired. None of the nine mutations related to KC have been previously reported.

Since the first case of KC was confirmed in 1854 [10], numerous studies were conducted to uncover the potential pathophysiology. It should be noted that positive family history was found in 6–20% of KC cases [11], and concordance between monozygotic twins was confirmed compared with monozygotic twins, which suggest that genetic factors are dominant components in KC etiology.

As is well known, the human cornea is rich in extracellular matrix (ECM), which maintains corneal transparency and biomechanical strength [12]. Through medical biochemistry techniques—such as immunostaining technology—and proteomics, different abnormalities related to varying risk genes in the expression of ECM components were identified in KC patients [13]. To date, more than ten KC-related genes have been identified as related to ECM component abnormality [13–16]. In the present study, two KC-related mutations were identified in two well-known ECM-associated genes (TGFBI and COL4A4). In KC patients, Bykhovskaya et al. identified a significantly unregulated transcript of the gene TGFBI, which was reported as related to the down-regulation of collagen genes (such as COL5A1, coding for collagen V) in ECM and caused decreased CCT [13]. TGFBI encodes the TGFβ-induced protein and works as a transcription regulator; this extracellular protein can also mediate cell adhesion to collagen, laminin, fibronectin, and proteoglycans [17]. In this study, the coding region of TGFBI was screened, and one novel TGFBI mutation (c.624 + 7->A) was identified, which further confirmed that TGFBI might be a risk gene for KC patients in China. Collagens are the main components of ECM, and the type IV collagen family (COL4A1 to COL4A6) consists of the corneal basement membrane[18]. The COL4A4 gene was expressed by the central corneal epithelium. With respect to the function of collagen IV, COL4A4 was also suggested to be a candidate risk gene for KC [19–20]. In this study, one COL4A4 ( c.3636_3637del:p.R1212fs) that has never been reported in Chinese KC patients was identified.

Recent studies show that part of the genes involved in KC development were related with CCT. In the present study, FNDC3B and MPDZ are widely thought of as CCT-related genes, and progressive corneal thinning is known to be a feature of the pathophysiology of KC. Lu et al. reported that rs4894535 in FNDC3B and rs1324183 in MPDZ led to decreased CCT with GWAS [21], and the results were replicated in studies by Hao and Sahebjada [22–23].In the present study, one novel FNDC3B (c.455C > T:p.P152L) mutation and three MPDZ (c.5015G > T:p.R1672L; c.3798dupA:p.P1267fs; c.28G > A:p.A10T) mutations were identified in Chinese KC patients; this was consistent with former studies and provided strong genetic evidence that variants in these two genes lead to increased susceptibility to KC. Nevertheless, the role of FNDC3B and MPDZ in KC remains elusive.

DOCK9 variants were first indicated to be related to KC risk in an Ecuadorian family [24]. Former fundamental studies have shown that DOCK9 could work as an activator of the cell division cycle and regulate the would repairing process in the human cornea [24]. With next-generation sequencing technology, this study’s KC cohort found one novel mutation (c.1940C > T:p.P647L) that was located in the exon region in DOCK9, and the mutation was predicted to be damaging by SIFT.

IPO5, which encodes a member of the kariopherin super-family and is involved in protein nuclear transport[25–26], was also screened in our study. One novel mutation (c.3019G > A:p.V1007I) was indicated to be related to KC in this Chinese KC cohort. Consistent with us, Justyna et al. also reported IPO5 mutations in Polish KC patients [27].

We also screen the coding region of POLG, which encodes the only DNA polymerase present in mammalian mitochondria [28–29]. Wojcik et al. provided strong evidence that the POLG gene might play a vital role in KC pathogenesis and determining the risk of this corneal disease [30].However, genetics studies about the relationship between KC and POLG are limited. The results of this study provided new evidence that supports Wojcik’s conclusion.

This study had some limitations. First, the limited sample size influenced the significance of the present study. Secondly, just the coding region of the identified genes was screened, while deep intronic substitutions could also induce KC formation. Thirdly, negative family history indicated that all involved patients were sporadic. Thus, it is difficult to define the genetic pattern of novel mutations. In our view, the absence of these mutations in the majority of Chinses KC patients suggests that its role is not dominant, and the phenotype of the next generation would help to define the genetic pattern. Further researches should be designed to uncover the potential role of the novel mutations in KC etiology by analysis of the corneal characteristics of genetic manipulation in animal models and corneal materials obtained from keratoplasty surgeries of mutations carriers.

The exact etiology of KC remains elusive. Our study screened sixteen reported KC genes and identified nine novel mutations in FNDC3B, COL4A4, MPDZ, DOCK9, POLG, IPO5, and TGFBI and enlarged the gene profile of KC and should be further confirmed by well-powered, genome-wide association studies (GWAS) of Han Chinese patients.

Keratoconus

SIFT

The Sorting Intolerant from Tolerant

SNPs

single nucleotide polymorphisms

GWAS

genome-wide association studies

WES

whole-exome sequencing

NFIB

nuclear factor I B

LIG3

DNA ligase 3

XRCC1

X-ray repair cross complementing 1

transferrin

ZEB1

zinc finger E-box binding homeobox 1

NEIL1

nei like DNA glycosylase 1

FNDC3B

fibronectin type III domain containing 3B

COL4A4

collagen type IV alpha 4 chain

MPDZ

multiple PDZ domain crumbs cell polarity complex component

DOCK9

dedicator of cytokinesis 9

TGFBI

transforming growth factor beta induced

PARP1

poly(ADP-ribose) polymerase 1

POLG

DNA polymerase gamma

IPO5

importin 5

FASLG

Fas ligand

IL1B

interleukin 1 beta

PCR

Polymerase Chain Reaction

CCT

Central corneal thickness

oculus dexter

oculus sinister

ECM

extracellular matrix

Ethics approval and consent to participate

The study was approved by the ethics committee of the Second Affiliated Hospital, Medical College of Zhejiang University, Hangzhou, China. This study adhered to the tenets of the Declaration of Helsinki and the statement on human subjects by the Association for Research in Vision and Ophthalmology. All participants provided written informed consent forms for both genetic counselling and molecular genetic testing prior to enrolment.

Consent for publication

Written informed consent for publication was obtained from all participants.

Availability of data and material

The datasets used and/or analysed during the current study are available from the

corresponding author on reasonable request.

Competing interests

The authors declare that this research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Funding

This research was supported by the National Natural Science Foundation of China under Grant No.81800869；No.81970781; No.81670834; No.81800807), Zhejiang Province Natural Science Foundation of China under Grant No.LY17H120002; No.LY17H090004).

Authors' contributions

ZX: Conceptualization, Methodlogy, Software ；YN Dat curation, Writng- Orignal draft prepartion；CB: Visualization, Investigation ；SX: Supervison ，Project adminstraion,Writng- Reviwing and Editng ；CL: Software, Validation; YH: Writng- Reviwing and Editng. All authors have read and approved the manuscript.

Acknowledgements

Not applicable.

Rabinowitz YS, 1998. Keratoconus. Surv Ophthalmol, 42: 297–319.
Kok YO, Tan GF, Loon SC, 2012. Review: keratoconus in Asia. Cornea, 31:581-93
Yu X, Chen B, Zhang X, Shentu X, 2017. Identification of seven novel ZNF469 mutations in keratoconus patients in a Han Chinese population. Mol Vis, 23: p. 296-305.
Wheeler J, Hauser M A, Afshari N A, Allingham R R, Liu Y, 2012. The Genetics of Keratoconus: A Review. Reprod Syst Sex Disord, Suppl 6.
Lucas S E M, Zhou T, Blackburn N B, Mills R A, Ellis J, Leo P, Souzeau E, Ridge B, Charlesworth J C, Lindsay R, Craig J E, Burdon K P, 2018. Rare, potentially pathogenic variants in 21 keratoconus candidate genes are not enriched in cases in a large Australian cohort of European descent. PLoS One, 13(6): p. e0199178.
Rabinowitz, Y.S., L. Dong and G. Wistow, 2005. Gene expression profile studies of human keratoconus cornea for NEIBank: a novel cornea-expressed gene and the absence of transcripts for aquaporin 5. Invest Ophthalmol Vis Sci，46(4): p. 1239-46.
Czugala M, Karolak J A, Nowak D M, Polakowski P, Pitarque J, Molinari A, Rydzanicz M, Bejjani B A, Yue B Y J T, Szaflik J P, Gajecka M, 2012. Novel mutation and three other sequence variants segregating with phenotype at keratoconus 13q32 susceptibility locus. Eur J Hum Genet, 20(4): p. 389-97.
Wang Y M, Ma L, Lu S Y, Chan T C Y, Yam J C S, Tang S M, Kam K W, Tam P O S, Tham C C, Young A L, Jhanji V, Pang C P, Chen L J, Analysis of multiple genetic loci reveals MPDZ-NF1B rs1324183 as a putative genetic marker for keratoconus. Br J Ophthalmol., 02(12):1736–1741.
Yu X, Chen B, Zhang X, Shentu X, 2017. Identification of seven novel ZNF469 mutations in keratoconus patients in a Han Chinese population. Mol Vis, 23:296–305. Published 2017 Apr 28.
Nottingham J, 1854. Practical observations on conical cornea, and on the short sight, and other defects of vision connected with it. London ;Liverpool: JohnChurchill ;Deighton & Laughton.
Kennedy RH, Bourne WM, Dyer JA, 1986. A 48-year clinical and epidemiologic study ofkeratoconus. Am J Ophthalmol , 101:267–73.
Feneck E M, Lewis P N, Ralphs J, Meek K M., 2018. A comparative study of the elastic fibre system within the mouse and human cornea. Exp Eye Res, 177: p. 35-44.
Bykhovskaya Y, Gromova A, Makarenkova H P, Rabinowitz Y S, 2016. Abnormal regulation of extracellular matrix and adhesion molecules in corneas of patients with keratoconus. Int J Keratoconus Ectatic Corneal Dis， 5(2): p. 63-70.
Xu X, Zhang X, Cui Y, Yang H, Ping X, Wu J, Yu X, Jin X, Huang X, Shentu X, 2020. Three Novel Variants Identified Within ECM-related Genes in Chinese Han Keratoconus Patients .Sci Rep, Apr 3, 10(1):5844. doi: 10.1038/s41598-020-62572-0.
Saravani R, Yari D, Saravani S, Hasanian-Langroudi F, 2017 . Correlation Between the COL4A3, MMP-9, and TIMP-1 Polymorphisms and Risk of Keratoconus. Jpn J Ophthalmol , May,61(3):218-222.
Dudakova L, Liskova P, Trojek T, Palos M, Kalasova S, Jirsova K, 2012 . Changes in lysyl oxidase (LOX) distribution and its decreased activity in keratoconus corneas. Exp Eye Res, Nov.104:74–81.
Engler C, Chakravarti S, Doyle J, Eberhart C G, Meng H, Stark W J, Kelliher C, Jun A S, 2011. Transforming growth factor-beta signaling pathway activation in Keratoconus. Am J Ophthalmol, 151(5): p. 752-759.e2.
Bai X, Dilworth D J, Weng Y, Gould D B, 2009. Developmental distribution of collagen IV isoforms and relevance to ocular diseases. Matrix Biol, 28:194–201.
Stabuc-Silih M, Ravnik-Glavac M, Glavac D, 2009. Polymorphisms in COL4A3 and COL4A4 genes associated with keratoconus. Mol Vis, 15:2848–2860.
Rong S S, Ma S T U, Yu X T, Ma L, Chu W K, Chan T C Y, Wang Y M, Young A L, Pang C P, Jhanji V, Chen L J, 2017. Genetic associations for keratoconus: a systematic review and meta-analysis. Sci Rep, 7, (1):4620. Published 2017 Jul 4.
Lu Y, Vitart V, Burdon K P, Khor C C, Bykhovskaya Y, Mirshahi A, Hewitt A W, Koehn D, Hysi P G, Ramdas W D, Zeller T, Vithana E N, Cornes B K, Tay W, Tai E S, Cheng C, Liu J, Foo J, Saw S M, Thorleifsson G, Stefansson K, Dimasi D P, Mills R A, Mountain J, Ang W, Hoehn R, Verhoeven V J M, Grus F, Wolfs R, Castagne R, Lackner K J, Springelkamp H, Yang J, Jonasson F, Leung D Y L, Chen L J, Tham C C Y, Rudan I, Vatavuk Z, Hayward C, Gibson J, Cree A J, Macleod A, Ennis S, Polasek O, Campbell H, Wilson J F, Viswanathan A C, Fleck B, Li X, Siscovick D, Taylor K D, Rotter J I, Yazar S, Ulmer M, Li J, Yaspan B L, Ozel A B, Richards J E, Moroi S E, Haines J L, Kang J H, Pasquale L R, Allingham R R, Ashley-Koch A, Mitchell P, Wang J J, Wright A F, Pennell C, Spector T D, Young T L, Klaver C C W, Martin N G, Montgomery G W, Anderson M G, Aung T, Willoughby C E, Wiggs J L, Pang C P, Thorsteinsdottir U, Lotery A J, Hammond C J, van Duijn C M, Hauser M A, Rabinowitz Y S, Pfeiffer N, Mackey D A, Craig J E, Macgregor S, Wong T Y, Genome-wide association analyses identify multiple loci associated with central corneal thickness and keratoconus. Nat Genet, 45: 155–163.
Hao XD, Chen P, Chen ZL, Li SX, Wang Y, 2015. Evaluating the Association between Keratoconus and Reported Genetic Loci in a Han Chinese Population. Ophthalmic Genet, 36(2):132–136.
Sahebjada S, Schache M, Richardson A J, Snibson G, Macgregor S, Daniell M, Baird P N, 2013. Evaluating the association between keratoconus and the corneal thickness genes in an independent Australian population. Invest Ophthalmol Vis Sci, 54:8224–8228
Karolak J A, Rydzanicz M, Ginter-Matuszewska B, Pitarque J A, Molinari A, Bejjani B A, Gajecka M, 2015.Variant c.2262A>C in DOCK9 Leads to Exon Skipping in Keratoconus Family. Invest Ophthalmol Vis Sci, 56(13): p. 7687-90.
Byun Y, Kang B, Yoo Y, Joo C, 2015. Poly(ADP-Ribose) Polymerase Inhibition Improves Corneal Epithelial Innervation and Wound Healing in Diabetic Rats. Invest Ophthalmol Vis Sci, 56(3): p. 1948-55.
Sirchia F, Di Gregorio E, Restagno G, Grosso E, Pappi P, Talarico F, Savin E, Cavalieri S, Giorgio E, Mancini C, Pasini B, Mehta J S, Brusco A, 2017. A case of Feingold type 2 syndrome associated with keratoconus refines keratoconus type 7 locus on chromosome 13q. Eur J Med Genet60(4):224–227.
Karolak J A, Polakowski P, Szaflik J, Szaflik J P, Gajecka M, 2016. Molecular Screening of Keratoconus Susceptibility Sequence Variants in VSX1, TGFBI, DOCK9, STK24, and IPO5 Genes in Polish Patients and Novel TGFBI Variant Identification. Ophthalmic genetics, 37(1): p. 37-43.
Copeland W.C., Longley M.J, 2003. DNA polymerase gamma in mitochondrial DNA replication and repair. Sci. World J, 3:34–44.
De Vries M.C., Rodenburg R.J., Morava E., van Kaauwen E.P., ter Laak H., Mullaart R.A., Snoeck I.N., van Hasselt P.M., Harding P., van den Heuvel L.P, 2007. Multiple oxidative phosphorylation deficiencies in severe childhood multi-system disorders due to polymerase gamma (POLG1) mutations. Eur. J. Pediatr, 166:229–234.
Wojcik K A, Synowiec E, Sobierajczyk K, Izdebska J, Blasiak J, Szaflik J, Szaflik J P, 2014. Polymorphism of the DNA base excision repair genes in keratoconus. Int J Mol Sci, 15(11): p. 19682-99.

Download PDF

Journal Publication

published 10 Feb, 2022

Read the published version in Journal of Ophthalmology →

Version 1

posted

You are reading this latest preprint version

Novel mutations identified in the Chinese Han population with keratoconus by next-generation sequencing

Status:

Journal Publication

Version 1

Abstract

BACKGROUND

METHODS

RESULTS

CONCLUSION

Figures

Background

Methods

Results

Discussion

Conclusions

Abbreviations

Declarations

Ethics approval and consent to participate

Consent for publication

Availability of data and material

Competing interests

Funding

Authors' contributions

Acknowledgements

References

Status:

Journal Publication

Version 1