Animal model
The male adult albino mice of AKR strain were used for the experiments. Mice were maintained at 25 ± 2°C as per the guideline of the Institutional Animal Ethical Committee in the animal house of the department. The mice were sacrificed by euthanasia and cervical dislocation to dissect out brain for experimental purposes. The experiments were carried out three times using brain of adult male mice (n = 5) per experiment.
In silico analysis of interacting proteins and promoter sequence elements of Pax5 and Pax6
The Pax5 and Pax6 interacting proteins in mice were analyzed using http://string-db.org/ and evaluated by interaction scores shown in the string database. Annotation of Pax5 and Pax6 biological functions and signaling pathways were based on the interacting proteins, separately. The promoter sequences of Mus musculus Pax5 and Pax6 were retrieved from Eukaryotic Promoter Database (https://epd.vital-it.ch/index.php). The transcription factor search motifs for binding of Pax5 on Pax6 promoter sequence and Pax6 on Pax5 promoter sequences were analyzed.
Chromatin-Immunoprecipitation (ChIP) with anti-Pax5 and anti-Pax6 in brain of mice
The Chromatin Immunoprecipitation was performed as described earlier [13]. Briefly, the lysate of the adult brain was prepared. Cross-linking and chromatin preparation from lysate was done by 1% formaldehyde. The cross-linking reaction was stopped by adding 125mM glycine. Nuclear extract was collected by centrifugation at 10,000xg for 10 min. Nuclear lysis was performed in ChIP-lysis buffer followed by sonication. Typically four rounds, 30-sec pulse with 1 min rest in between rounds at output 5.0 (LABSONIC L, B. Braun Biotech International GmbH, Germany). The desired DNA fragment was between 0.5kb to 1kb in length. The supernatant after sonication containing chromatin was incubated for 4 hours at 4oC for Immunoprecipitation with anti-Pax5 antibody (anti-mouse, sc-13146, Santa-Cruz Biotech, USA) and anti-Pax6 antibody (anti-mouse, sc-32766). In control, anti-human IgG (HPO-1, Merk, India) was used. After centrifugation at 10,000xg, reverse linking was performed by adding 120mM NaCl and incubation at 65oC for 1 hour. DNA obtained through Immunoprecipitation was purified through the phenol: chloroform purification method. The pulled DNA was checked on 1% agarose gel. Chromatin prepared without antibody was reverse linked to obtaining input DNA. The qPCR was performed to calculate fold enrichment of promoter Pax5 and Pax6 gene in input DNA, anti-Pax5 and anti-Pax6 pulled DNA and negative control. The primers sequence used were Pax5F, 5′ CGGACCATCAGGACAGGA 3′, Pax5R, 5′ GGGCTCGTCAAGTTGG 3′; Pax6F, 5′GAGGTCAGGCTTCGCTAATG 3′, Pax6R, 5′ TCCAACAGCCTGTGTTGTTC 3′.
Analysis of the interaction of Pax5 and Pax6 by Co-Immunoprecipitation (Co-IP) in brain of mice
For Co-Immunoprecipitation, 50µl of Protein-A bead was taken into a spin column and washed twice with 1ml 1X IP buffer by centrifugation at 3000rpm for 20 seconds. 2µg of anti-Pax5 (anti-mouse, sc-13146, Santa-Cruz Biotech, USA) and anti-Pax6 (anti-mouse, sc-32766, Santa-Cruz Biotech, USA) diluted to 200µl in buffer were added to each column containing resin, respectively. The columns were incubated at 4°C for 30 minutes. After 30 minutes, the resin was washed with 1ml cold 1X IP buffer thrice and 150µl of adult mice brain tissue lysate was added to each column, respectively. Then columns were incubated for 1hr at 4°C and washed with cold 1X IP buffer thrice. In the negative control, the beads were incubated with antibodies and lack brain tissue lysate. After washing, 100µl of sample loading buffer was added to the resin, mixed well and the suspension was transferred into the 1.5ml microfuge tube [14, 16]. Samples were heat-denatured for 5 minutes, centrifuged for 1 min at 3000rpm and 50µl of the samples were resolved through 12% SDS-PAGE and analysed by Western blotting for Pax5 and Pax6-reactive peptide band, respectively.
Analysis of expression and co-localization of Pax5 with Pax6 in brain of mice
The antigen retrieval of cryo-sections was done in 0.1% trypsin+0.1% CaCl2 for 10 min. Sections after antigen retrieval were blocked with 1% BSA for 1 hour. For double labeling, anti-Pax5 (anti-mouse, sc-13146, Santa-Cruz Biotech, USA, 1:500 dilution) and anti-Pax6 (anti-mouse, sc-32766, Santa-Cruz Biotech, USA, 1:200 dilution) antibodies were used at 4°C for overnight. The sections were washed with PBS and probed with TRITC (red) goat anti-mouse IgG secondary antibody, FITC (green) conjugated goat anti-mouse IgG secondary antibody (1:2000 dilution) (Merk, India), separately for 2h each for detecting Pax5 and Pax6 immunoreactivity. In the negative control, slides were stained with TRITC (red) goat anti-mouse IgG secondary antibody, FITC (green) conjugated goat anti-mouse IgG secondary antibody (1:2000 dilution) without incubating with primary antibody. The slides were washed with PBS with Tween 20 (0.02%) and counterstained with DAPI (Molecular Probe) for nuclear staining as previously described [14, 16]. Imaging was performed using a fluorescence microscope (Evos FLc) and confocal microscope (Zeiss LSM 780). Image analysis was performed by Zen software.