Cell culture and differentiation
Human ADSCs were purchase from the Cell Bank (Shanghai Institutes, China) for Biological Sciences and were cultured in DMEM/F12 1:1 medium (Gibco; Thermo Fisher Scientific, Inc. USA) supplemented with 10% fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific, Inc. USA). Cells were incubated in a humidified chamber with a temperature of 37 ℃ and a CO2 concentration of 5%. Adipogenic differentiation was induced in the cells were induced by incubating them in DMEM/F12 medium supplemented with 10% FBS, 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone, and 5 μg /mL insulin at 37 ℃ for 2 days. This medium was then replaced with DMEM/F12 supplemented with 10% FBS and 5 μg /mL insulin every two days.
Transfection
Human HCP5 sequence (GenBank, NR_040662.1) was synthesized and subcloned into a pcDNA3.1 vector (Genepharma, Shanghai, China) for transfection, with the empty vector acting as a vehicle control. HCP5 knockdown relied on a lentiviral vector, pGLVH1/GFP+Puro (Genepharma, Shanghai, China), expressing an shRNA against HCP5. The sequences of the shRNA and its negative control were as follows: 5′‐GCAGTGTGCTTCCTTCCTT‐3′ and 5′‐TTCTCCGAACGTGTCACGT‐3′. The sense and anti-sense sequences for the miR-27a-3p mimics (Genepharma, Shanghai, China) were 5′-UUCACAGUGGCUAAGUUCCGC-3′ and 5′-GGAACUUAGCCACUGUGAAUU-3'. The sequences of the sense and anti-sense negative control were 5′-UUCUCCGAACGUGUCACGUTT-3′ and 5′-ACGUGACACGUUCGGAGAATT-3'. The sequence of the miR-27a-3p inhibitor (Genepharma, Shanghai, China) was 5′-GCGGAACUUAGCCACUGUGAA-3′, and that of its negative control was 5′-CAGUACUUUUGUGUAGUACAA-3'. The sequences of the siRNA against PPARγ and its negative control were 5′‐AGUUUGCUGUGAAGUUCAAUG‐3′ and 5′‐UUGAACUUCACAGCAAACUCA‐3′. HCP5 interactions with miR-27a-3p were evaluated using by co-transfection of the HCP5 vector (or NC vector) and the miR-27a-3p mimics (or mimics NC) or the HCP5 shRNA (or shRNA NC) and miR-27a-3p inhibitor (or inhibitor NC). Interactions between HCP5 and PPARγ were evaluated using co-transfections of the HCP5 vector (or NC vector) and PPARγ siRNAs (or siRNA NC). All cells were transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol, and all subsequent experiments were completed 48 h post-transfection.
Oil Red O staining
ADSCs were cultured in induction medium and then stained with oil-red O at 0, 2, 4, 6 and 8 days to evaluate adipogenic differentiation in response to changes in HCP5 expression. Next, we evaluated whether HCP5 regulates adipogenic differentiation in ADSCs via its interaction with miR-27a-3p. Therefore, we co-transfected ADSCs with pcDNA3.1-HCP5 and miR-27a-3p mimics. We also co-transfected ADSCs with HCP5 shRNA and an miR-27a-3p inhibitor and then subjected the cells to 4 days of culture in the adipose induction medium. We then evaluated their adipogenic differentiation using oil red O staining. After removing the induction medium, the ADSCs were washed with PBS twice. They were fixed with 4% paraformaldehyde for 30 min at 20 ℃, following which, the paraformaldehyde was removed by washing the cells twice in PBS. We then treated the cells with Oil Red O solution for 30 min and then washed the cells three times with PBS. After staining, plates were placed on a white background. Photos were taken to observe and compare the number of red-stained cells.
Immunofluorescence
Using immunofluorescence studies, we evaluated the expression of PPARγ in cells. Cells were fixed using 4% paraformaldehyde for 30 min at 20 ℃, following which, the paraformaldehyde was removed by washing the cells twice in PBS. They were then incubated with primary anti-PPARγ antibody (ab209350, Abcam, Cambridge, UK) and primary anti-β tubulin antibody (ab78078, Abcam, Cambridge, UK) at 4 ℃ for 8 h, washed, and then incubated with goat anti-rabbit IgG (FITC) secondary antibody (ab6717, Abcam, Cambridge, UK ) and goat anti-mouse IgG (DyLight549) secondary antibody (a23310, Abbkine, California, USA) for 1 h at 20 ℃. Next, the cells were counterstained with DAPI (c0060, Solarbio) for 5 min and visualized using a fluorescence microscope (400×) fitted with a camera (Olympus, Japan).
qRT-PCR
Trizol reagent (Invitrogen; Thermo Fisher Scientific) was used to extract each group’s total RNA, and the quantity and quality of this RNA were then evaluated using a Nanodrop ND-2000 spectrophotometer. We used 2 µg of total RNA for both the mRNA and lncRNA expression analysis, which was reverse transcribed to cDNA. A RevertAid First Strand cDNA Synthesis kit (Thermo Scientific™, USA) was used. The template used for the miRNA analysis was reverse transcribed into cDNA using a miDETECT A Track™ qRT-PCR kit (RiboBio, Guangzhou, China). SYBR Green PCR Master Mix (Applied Biosystems, Foster, CA, USA) was used to perform the qRT-PCR according to the manufacturer, using an ABI 7500 (Applied Biosystems, Foster, CA, USA). Primer sequences for HCP5 were as follows: forward 5′-TATCCCTGTGAAGATGAACC-3′, reverse 5′-TGCCACCTCTAAATGTCCTA-3′. Primer sequences for PPARγ were as follows: forward 5′-GACGAGCTCCAGAAAAGTCCCAGTCGCTGACAAAG-3′, reverse: 5′-CATCTCGAGTA TTAAAAGTAAATTGTAAATGTATC-3′. Primer sequences for miR-27a-3p: forward 5′-GCCGCTTCACAGTGGCTAA-3′, reverse: 5′-GTGCAGGGTCCGAGGTATTC-3′. Primer sequences for GAPDH were as follows: forward 5′‐CGGAGTCAACGGATTTGGTCG‐3′, reverse 5′ ‐TCTCGCTCCTGGAAGATGGTGAT‐3′. Primer sequences for U6 were as follows: forward 5ʹ-CTCGCTTCG GCAGCAGCACATATA-3ʹ, reverse: 5ʹ-AAATATGGAACGCTTCACGA-3ʹ. Either GAPDH or U6 was used as the control depending on the assay, and relative expression was calculated using the 2-ΔΔCt method. Each evaluation was repeated three times.
Luciferase reporter assay
We then validated these predictions using a dual-luciferase reporter assay using luciferase reporters with both the WT and mutant binding sequence from HCP5 and the WT and mutant binding sequences from PPARγ. A luciferase-based reporter assay was performed to evaluate the specific interactions within our ceRNA network. We constructed two PGL3 (Promega, Madison, USA) reporter constructs. The wild-type (WT) HCP5 or the mutant (Mut) HCP5 sequence was cloned. We constructed a second similar set of reporters to evaluate miR-27a-3p binding of PPARγ, with the WT PPARγ or Mut PPARγ sequence inserted. ADSCs were then cultured and transfected in a 96-well plate. Forty-eight hours after transfection, the cells were harvested, and the luciferase activity was measured using a Dual-Luciferase Reporter Assay kit (Promega, Madison, USA). These assays were performed in triplicate.
Western blotting
Cells were lysed by RIPA (Beyotime Institute of Biotechnology, Haimen, China) . The BCA protein assay kit (Wanleibio, Co., Ltd., Shanghai, China) was used to quantify the harvested protein. A total of 20 μg/lane protein were separated using 10% SDS-PAGE and then transferred onto a polyvinylidene difluoride membrane. The membranes were blocked with 5% skimmed milk powder in Tris-buffered saline-0.1% Tween-20 (TBST) at 20 °C for 2 h. Then the membranes were incubated with following primary antibodies overnight at 4 °C:.anti-PPARγ (ab209350, Abcam, Cambridge, UK, 1:1000 ) and anti-GAPDH (ab9485,Abcam, Cambridge, UK, 1:2000 ). The membranes were then washed three times in TBST and incubated with a horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (ab288151, Abcam, Cambridge, UK, 1:10000 ) for 2 h at 20 °C. Finally, the protein bands were visualized using a chemiluminescence detection system ( SuperSignal™West Pico PLUS, Thermo Fisher Scientific, Inc.). Image-pro Plus software (version 6.0; Media Cybernetics, Inc.) was used to quantified protein expressions.
Statistical analysis
All continuous variables are described as the mean ± SEM, and all statistical analyses were performed using SPSS version 13.0 software (SPSS, Inc.). Differences between groups were evaluated using an unpaired Student's t-test, and statistical significance was set at a P-value of < 0.05. All experiments were performed in triplicate.