Experimental reagent
RAW264.7 mouse mononuclear macrophage leukemia cells cells were purchased from the Kunming cell bank of the committee of typical culture preservation, Chinese academy of sciences. TGF-β1、 IFN-γ、TNF-α, purchased from Peprotech company; LPS purchased from Sigma; iNOS、 IL-4 、Arg-1、 CD206, purchased from Cell signaling technology. The genetic primer for Wip1 was synthesized by Takara. Plasmid extraction using the Omega plasmid large extraction kit. The protocol of study was approved by the ethics committee of Xi'an Jiaotong University.
Culture, Induction and identification of macrophages
The RAW264.7 macrophages in good condition were cultured and resuspended in 1640 culture medium of 1%FBS. The cell counting plate was used to count the cells, and the cell concentration was adjusted to 5×10^5/ml. The cells were seeded into a 6-well plate and 2ml of the above cell suspension was added into each well. Lipopolysaccharide (LPS 100 ng/ml) and IFN-γ (2.5 ng/ml) were added to each well for 12 hours to induce M1 macrophages. IL-4 (10ng/ml) was cultured in each well for 12 h to induce M2 macrophages. The cells in the 6-well plate were divided into 3 groups. After the induction period, the cells were gently washed with PBS for 3 times, replacing the liquid, and the changes in cell morphology were observed. The macrophage phenotype was detected by ELISA method: the level of iNOS, TNF-α, Arg-1 and CD206 in culture media were measured to determine the changes of macrophage phenotype. Take out the supernatant of the culture solution, adjust the sample gun to 100μl, add the standard sample and the sample to be tested, 100μl per hole. Add enzyme labeled coupling solution, 50μl per hole. After slightly shaking the pores, they were put into the water bath box and incubated for 60min. Wash plate 10 minutes before, prepare liquid A and liquid B and store them away from light. After incubation, take out 96-well plates and place them on the washing machine. Wash the plates 5 times. Add A, B liquid, after adding the sample, place the cover of the water bath box and incubate for 15 minutes in dark. Record time; At the end of incubation time, the enzyme plate was taken out and the water was sucked dry on the filter paper. Add termination fluid; OD value was measured on the enzyme marker for three times.
Construction of WIP1 overexpression and RNAi interference by lentivirus transfection
Construction and identification of lentiviral vector lenti-Wip1
The gene sequence of Wip1(Ppm1d-001)was searched in Genbank, the PCR primers(The sequence is Wip1 F 5’-ggttaattaaATGGCGGGGCTGTACTCGCTG-3’;Wip1 R 5’-ccgttaccTCAGCACACACACACTGTTTTCC-3’)were designed with Primer-3, and PacI and PmeI cleavage sites were added at the two ends of the primers, the fragment size was 1832 bp.
Transfection of 293T cells with lentiviral vector
Prepare 293T cells (cell density ~70%-80%) for transfection, and evenly spread 0.5~1×10^6 cells in a 5ml cell culture dish one day before transfection. The prepared transfection reaction system was added to the prepared culture dish of 293T cells, and the virus supernatant was collected after 48 hours of culture, then filtered and stored at-80 °C.
Construction of lentiviral vector LV-shWip1
According to the RNA interference (RNAI) sequence of Wip1 gene selected from websites, the first 3 pairs of the 10 pairs of sequences are usually selected in order to synthesize the target sequence (the approximate fragment size is 50 ~ 60 bp)
(1)shWip1-1#F:CCGGGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGGCTTTTTG;
1#R:AATTCAAAAAGCCCATCTTCTGAGTTGTAAACTCGAGTTTACAACTCAGAAGATGGG;
(2)shWip1-2#F:CCGGTCGAGTGAGGACGACGATTTACTCGAGTAAATCGTCGTCCTCACTCGATTTTTG;
2#R:AATTCAAAAATCGAGTGAGGACGACGATTTACTCGAGTAAATCGTCGTCCTCACTCGA;
(3)shWip1-3# F:CCGGGTATATTCTCACGCGGAATTTCTCGAGAAATTCCGCGTGAGAATATACTTTTTG;
3#R:AATTCAAAAAGTATATTCTCACGCGGAATTTCTCGAGAAATTCCGCGTGAGAATATAC.
After enzyme digestion, the vector was linked to the synthetic target sequence, and the positive vector was confirmed by sequencing. The virus was packaged in 293T, the virus was collected, mononuclear macrophages were infected, the positive transfected cells were screened for drugs, RNA of positive cells was extracted, and the silencing efficiency of Wip1 gene was detected. Protein extraction, Western blot was used to detect the expression of lentiviral vector.
The phenotypic changes of macrophages were determined by ELISA
When mouse derived macrophage RAW264.7 was interfered with Wip1 overexpression and RNAi interference vector, it was found that macrophages with Wip1 overexpression had high expression of iNOS and TNF-α, while macrophages with RNAi interference had high expression of Arg-1 and CD206.
The Primary Cultured Renal Tubular epithelial cells were co-cultured with the above-mentioned macrophages, and the changes of fibrosis indexes were detected by RT-PCR
The kidney was taken from 5-6 weeks old healthy male BalB/C mice and put into a sterile petri dish; The kidney tissue was cut into pieces repeatedly with ophthalmic scissors until it was cut into 0.5 ~ 1mm3 tissue pieces; 0.25% trypsin; Grind the kidney tissue on a sterile petri dish filter; 1ml was taken from the filtered cell suspension and the cell density after dilution was 5×105 ~ 1×106; The diluted cell suspensions were divided into culture vials, cultured in a CO2 incubator at 37 °C, and co-cultured with lentiviral over-expression vector Wip1 and RNAi vector to interfere with murine derived macrophages Raw264.7. After 72 hours, the cells were collected and the mRNA was extracted. The PCR product band was semi-quantitatively analyzed by gel image processing software and converted into numerical variables. Taking GADPH as internal reference, E-Cadhrin / GADPH, Vimentin / GADPH, α-SMA / GADPH, and computing the relative expression of E-Cadhrin, Vimentin, α-SMA.
Statistical
The data were processed by statistical analysis software SPSS13.0, and the measurement data were presented as mean ± standard deviation (). For inter-group comparison, the data were first tested for normality and homogeneity of variance. For multi-group comparison, one-way ANOVA was used, if the variance was equal to LSD test and if the variance was unequal to Dunnett t 3 tests, the difference was statistically significant (p < 0.05).