Animals and Experimental Design
Trpm1−/− mice were generated as described previously [1]. In this study, we analyzed Trpm1−/− mice with their wild type (WT) littermates on the 129Sv/Ev Taconic background. All behavioral tests were performed with male that were 11-12 weeks old at the starting of the testing (Trpm1−/− mice, n = 24; WT littermates, n = 24). Mice were housed as 2 pairs of Trpm1−/− and WT mice in a cage with a 12- hour light/dark cycle (light on 7:00 a.m. and off 7:00 p.m.). All mice had access to food and water ad libitum. Behavioral testing was performed between 8:30 A.M. and 6:30 P.M. unless otherwise noted. Our behavioral test battery consists of the tests listed in Table 1. After the tests, all the testing apparatus were cleaned with diluted hypochlorous solution or 70 % ethanol to prevent a bias due to olfactory cues.
Brain weight measurement and monoamine quantification in brain tissues were performed with 129Sv/Ev male at 4 months (Trpm1−/− mice, n = 24; WT littermates, n = 24) or 1 month (Trpm1−/− mice, n = 4; WT littermates, n = 5). Gene expression analysis was performed with 129Sv/Ev male at 1 month (WT, n = 5). Mice used for monoamine quantification were housed as 2 pairs of Trpm1−/− mice and WT mice in a cage with a 12- hour light/dark cycle (light on 8:00 a.m. and off 8:00 p.m.), and tissue dissection was performed at the same time point (1:00 p.m.). All mice had access to food and water ad libitum. The experimental procedures and housing conditions for animals were approved by Institutional Animal Care and Use Committee of National Institute for Physiological Sciences, Fujita Health University and Ritsumeikan University.
General health and neurological screen
A general health and neurological screen examined the body weight, rectal temperature, whisker, coat, simple reflexes such as righting, whisker touch, eye blink, ear twitch reflexes and reaching behavior using 11~12 weeks old, as described previously [19]. Grip strength test and wire hang test were conducted to measure muscle strength. Grip strength was measured by using a grip strength meter (O’Hara & Co., Japan). In the wire hang test, the mouse was placed on a wire cage lid that was then inverted, so that the subject gripped the wire. Latency to fall onto the bedding was recorded, with a 60 sec cutoff time.
Light/dark transition test
Light/dark transition test was performed as described previously [20–22]. The apparatus used for the light/dark transition test consisted of a cage (21 x 41.5 x 25 cm) divided into two sections of equal size by a partition with a door (O’Hara & Co., Japan). One section was brightly illuminated (390 ± 20 lux), whereas the other section was dark (< 2 lux). Mice were placed into the dark side of the apparatus, and allowed to move freely between the two sections for 10 min, while the door remained open. In the same way, mice (34-35 weeks old) were placed into the light side of the apparatus allowed to move freely between the two sections for 10 min. The total number of transitions, time spent in each section, initial latency to the light section, and distance traveled were recorded automatically using Image LD software.
Open field test
Open field test was performed as described previously [21,22]. Mice were allowed to move freely in an open field apparatus (40 × 40 × 30 cm; Accuscan Instruments, U.S.A.), which was illuminated at 10.0 lx for 120 min. Each subject was placed in the corner of the apparatus. The total distance, vertical activity (rearing measured by counting the number of photobeam interruptions), time spent in the center area, and stereotypic behaviors were recorded.
Elevated plus maze test
Elevated plus maze test was performed as described previously [21,23]. The apparatus (O’Hara & Co., Japan) consisted of two open arms (25 x 5 cm) and two enclosed arms of the same size, with a central square (5 x 5 cm). The closed arms have 16 cm high transparent walls. To minimize the likelihood of animals falling from the apparatus, 3-mm-high Plexiglas ledges were provided for the open arms. The arms and were made of white plastic plates and were elevated to a height of 50 cm above the floor. Arms of the same type were arranged at opposite sides to each other. Mice were placed in the central square of the maze, facing one of the closed arms and behavior was recorded during a 10-min test period. The percentage of open arm entries, the percentage of time spent on the open arms, the total number of arm entries, and the total distance traveled were measured automatically using Image EP software.
Hot plate test
Hot plate test was performed as described previously [23]. Mice were placed on a 55.0 °C hot plate (Columbus Instruments, U.S.A.), and latency to the first hind paw response was recorded. The hind paw response was either a foot shake or a paw lick.
Social interaction test
Social interaction test was performed as described previously [16]. A pair of mice (12-13 weeks old) was placed simultaneously at opposing corners in the open field apparatus (40 × 40 × 30 cm; O’Hara & Co., Japan), whose illumination level was 10.0 lx at the center of the floor, and allowed to explore freely for 10 min. The pair of mice had been housed in different cages. The number of active contacts, the number of contacts, mean duration per contact, the total duration of contact, and total distance traveled were measured. The analysis was performed automatically using Image SI software.
Rota-rod test
Motor coordination and balance were tested with the rota-rod test old as described previously [23]. The rota-rod test using an accelerating rota-rod (UGO Basile, Italy) was performed by placing a mouse on a rotating drum (3 cm diameter) and measuring the time each animal was able to maintain its balance on the rod. The speed of the rota-rod accelerated from 4 to 40 rpm over a 5-min period.
Social approach and novelty preference test
Social approach and preference for social novelty were tested with the three-chamber social test apparatus as described previously [21,23]. The apparatus comprised a rectangular, three-chambered box and a lid with a video camera (O’Hara& Co., Japan). Each chamber was 20 cm × 40 cm × 22 cm and the dividing walls had small openings (5 cm × 3 cm) to allow exploration into each chamber. The day before testing, the mice were individually placed in the middle chamber and allowed to freely explore the entire apparatus for 10 min. During the test session, the amount of time spent in each chamber and time spent around each cage were recorded and analyzed automatically using Image CSI.
Acoustic Startle response/prepulse inhibition tests
Acoustic Startle response/prepulse inhibition tests were performed as described previously [23] (O’Hara & Co., Japan). A test session began by placing a mouse in a Plexiglas cylinder where it was left undisturbed for 10 min. The duration of white noise that was used as the startle stimulus was 40 msec for all trial types. A test session consisted of six trial types (i.e., two types for startle stimulus-only trials and four types for prepulse inhibition trials). The intensity of startle stimulus was 110 or 120 dB. The prepulse was presented 10.0 msec before the startle stimulus, and its intensity was 74 or 78 dB. Four combinations of prepulse and startle stimuli were used (74 –110, 78 –110, 74 –120, and 78–120). Six blocks of the six trial types were presented in pseudorandom order such that each trial type was presented once within a block. The average intertrial interval was 15 sec (range, 10–20 sec).
Porsolt Forced Swimming test
Depression-related behavior was assessed, using the forced swimming test as described previously [19]. The apparatus consisted of Plexiglas cylinders (22 cm height x 12 cm diameter). The cylinders were filled with water (room temperature, 23±2 °C), up to a height of 7.5 cm. Mice were placed into the cylinders, and their behavior was recorded over a 10-min test period. Immobility and distance traveled were measured analyzed automatically using Image PS software.
Gait analysis
The gait during walk/trot locomotion was assessed using DigiGait Imaging System (Mouse Specifics, U.S.A.) as described previously [24]. Digital video images of the underside of mice were collected at 150 frames per second. We placed the mice on a treadmill belt that moves at a speed of 24.7 cm/s. The percent of the time of stride or stance duration, stride length, stance width, step angle and paw angle were calculated.
Barnes maze
The Barnes maze test was performed as described previously [19] . The circular open field (O’Hara & Co., Japan) was elevated 97 cm from the floor. Training sessions were conducted one to three per day. After 24 hours after the 15th training session, a probe test was conducted without the escape box, to confirm that this spatial task was acquired based on navigation by distal environmental room cues. One month after the last (16th) training session, probe trial tests were conducted again to evaluate memory retention. After five additional training sessions conducted after the memory retention test, the escape box was moved to a new position opposite to the original (reversal learning). Mice were then trained with 8 sessions to locate the new position of the escape hole using the same procedure as described above. Latency to reach the target hole, distance to reach the target hole, number of errors and time spent around each hole were recorded automatically using Image BM software.
T-maze Spontaneous Alternation
T-maze spontaneous alternation test was performed as described previously [22] using the automatic modified T-maze apparatus (O’Hara & Co., Japan). Mice were subjected to the spontaneous alternation protocol for 5 sessions. One session consists of 10 choices with a 50-min cutoff time. Mice were first placed in the start compartment of the T-Maze. Mice chose entering either the left or the right arm and could return to the start compartment. The mice were then given a 3-sec delay followed by a free choice between both T arms. A correct choice was made if the mouse entered the arm which was not visited in the previous choice. The percentage of the correct response, latency (sec) to complete a session, distance traveled during the session. Data acquisition was performed automatically using Image TM software.
Tail suspension test
Depression-related behavior was assessed by the tail suspension test as described previously [24]. Mice were suspended 30 cm above the floor in a visually isolated area by adhesive tape placed, 1 cm from the base of the tail, and their behavior was recorded over a 10-min test period. Data acquisition and analysis were performed automatically using Image TS software.
Contextual and cued fear conditioning
The ability of mice to learn and remember an association between environmental cues and aversive experiences was assessed by fear conditioning test as described previously [22,23]. Each mouse was placed in a test chamber (26 x 34 x 33 cm, O’Hara & Co., Japan) and allowed to explore freely for 2 min. A 55 dB white noise, which served as the conditioned stimulus (CS), was presented for 30 sec. Next, a mild (2 sec, 0.3 mA) foot shock, which served as the unconditioned stimulus (US), was presented immediately after the CS. Two more CS-US pairings were presented with a 2-min interstimulus interval. Context testing was conducted 1 day after conditioning in the same chamber for 30.0 sec without CS and US presentations.
Cued testing with altered context was conducted after conditioning using a triangular box (33 x 33 x 33 cm) made of white opaque Plexiglas, which was located in a different room. Mice are allowed to explore the chamber for 360 sec. In the first 3min, neither a CS nor US is presented, then a CS (a 55dB white noise) is presented for the last 3 min. Freezing and distance traveled were recorded. Data acquisition, control of stimuli (i.e. tones and shocks), and data analysis were performed automatically using Image FZ software.
Twenty-four-hour home cage monitoring test
The 24-hour home cage test was performed as described previously [22]. The system for monitoring social interaction comprised a home cage (19 × 29 × 13 cm) and a filtered cage top with an infrared video camera (O’Hara & Co., Japan). Two mice with the same genotype that had been housed separately were placed together in a home cage. To evaluate their locomotor activity and social interaction, their behavior was monitored with a video camera for a week. Distance traveled was measured automatically using ImageHA software. The occurrence of social interaction was detected by counting the number of particles consisting of the mice as follows: 2 particles indicated that the mice were not in contact whereas 1 particle indicated that 2 mice were in contact. Locomotor activity of the mice was also measured.
Methylphenidate administration in the open field
After the behavioral test battery, the behavioral response to methylphenidate (MPH) was assessed in the open field. A quarter of the area of the open field apparatus (20 × 20 × 30 cm) was used by installing a divider. Other conditions were the same as for the open field test. The mice of each genotype were randomly divided into two groups for treatment with MPH and saline. The experiment was repeated twice with varying drug doses. Locomotor activity was recorded continuously during the 60-min habituation period and for 120 min after injection of saline or MPH (3 mg/kg or 10 mg/kg).
Monoamine quantification in brain tissues
Monoamine transmitter quantification was performed as described previously [25]. Tissue concentrations of biogenic monoamines were analyzed after dissection in various brain regions; prefrontal cortex, hippocampus, striatum, cerebral cortex, olfactory bulb, cerebellum, midbrain, pons and medulla, thalamus, hypothalamus. The weight of the brain tissue was measured, and homogenized in 0.2 M ice-cold perchloric acid (including 10.0 µM EDTA・2Na) and the homogenates were cooled on ice for 30 min to deproteinize. The homogenates were centrifuged at 20,000 G for 15 min at 0 ℃. Then, the pH of the supernatant was adjusted to approximately 3.0 by adding 1 M sodium acetate. The samples were filtered through a 0.45 mm filter (Millipore, Billerica, USA). Next, 10 µL of the filtrate was loaded into a high performance liquid chromatography (HPLC) system (Eicom , Japan). The HPLC system had a ø3.0 mm x 150 mm octadecyl silane column (SC-5ODS, Eicom), and an electrochemical detector (ECD) (HTEC-50.0; Eicom, Japan) set to an applied potential of +750 mV versus an Ag/AgCl reference analytical electrode. The change in electric current (nA) was recorded using a computer interface at 25 ℃. The mobile phase was composed of 0.1 M aceto-citric acid buffer (pH 3.5), methanol, sodium-1-octane sulfonate (0.46 M), and EDTA・2Na (0.015 mM) [830: 170: 1.9: 1]. The flow rate was 0.5 mL/min.
Gene expression analysis in the brain
Total RNA was isolated from each brain part using Biomasher Ⅱ (nippi, Japan) and ISOGEN Ⅱ (NIPPON GENE, Japan). For complementary DNA (cDNA) synthesis, 1 µg of total RNA was reverse transcribed (RT) into cDNA using the SuperScriptⅢ (TaKaRa, Japan) according to the manufacturer’s instructions. For quantitative polymerase chain reaction (qPCR) was conducted on a Thermal Cycler Dice® Real Time System Ⅱ (TaKaRa, Japan) using TB Green® Premix Ex Taq™ Ⅱ (Tli RNaseH Plus) (TaKaRa, Japan) according to the manufacturer’s instructions. Primers for mouse Trpm1: forward, 5’-GAGATGCAGCCCAAACTGAAGC-3’; reverse, 5’-TGACGACACCAGTGCTCACA-3’. Primers for mouse b-actin: forward, 5’- CTCTGGCTCCTAGCACCATGAAGA -3’; reverse, 5’- GTAAAACGCAGCTCAGTAACAGTCCG -3’.
Corticosterone measurement
Blood was collected from mice at 4 months old by Cardiac puncture immediately after cervical dislocation. The serum was separated by centrifuging at 2,000 g for 20 min, and stored at -80 ℃ until use. Corticosterone measurements were performed on serum by enzyme-linked immunosorbent assay (ELISA) using a Corticosterone immunoassay (R&D Systems, U.S.A.) according to the manufacturer’s instructions.
Image analysis
Behavioral data were obtained automatically by customized applications based on a public domain ImageJ program (Image LD, Image EP, Image SI, Image CSI, Image PS, Image BM, Image TM, Image TS, Image FZ, Image HA). The ImageJ plugins, and the precompiled plugins for light/dark transition test (Image LD), elevated plus maze (Image EP), open field test (Image OF), fear conditioning test (Image FZ), and T‐maze (Image TM) are freely available on the website of “Mouse Phenotype Database” (http://www.mouse-phenotype.org/software.html).
Data analysis
All statistical analyses were performed using Graph Pad Prism7. Statistical methods are indicated in the figure legends. Data are presented as mean ± SEM. Unpaired 2-tailed Student’s t test or Welch’s t test were used for 2-group comparisons. Two-way analysis of variance (ANOVA) or repeated-measures two-way ANOVA following Tukey’s test and one-way ANOVA following Dunnett’s test was used for multiple comparisons. Unless otherwise noted, the p values are for the genotype effect.
Data repository
The raw data of the behavioral tests and the information about each mouse are accessible on the public database “Mouse Phenotype Database” (http://www.mouse-phenotype.org/).