Cell culture
The ovarian cancer cell line SK-OV-3 () containing 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA), 100 U/mL penicillin and 0.1 mg/mL streptomycin, with 5% CO2.
Cell counting kit-8 (CCK-8) assay
Cell proliferation after ghrelin treatment was assessed using the CCK-8 (K1018, Apexbio, Houston, TX, USA) kit. Cells (1 × 104 cells per well) were plated in the 96-well plates (100 µL/well) and 10 µL of CCK-8 solution was added at each time point (1d, 2d, 3d, 4d, 5d, 6d, and 7d) for 2 h at 37°C. The absorbance values at 450 nm were then measured using an enzyme marker.
RNA extraction and sequencing
Sequencing libraries were generated using the TruSeq RNA Sample Preparation Kit (Illumina, San Diego, CA, USA). Briefly, mRNA was purified from total RNA using poly-T oligo-attached magnetic beads. Fragmentation was carried out using divalent cations under elevated temperature in an Illumina proprietary fragmentation buffer. First strand cDNA was synthesize dusing random oligonucleotides and SuperScript II. Second strand cDNA synthesis was subsequently performed using DNA Polymerase I and RNase H. Remaining overhangs were converted into blunt ends via exonuclease/polymerase activities and the enzymes were removed. After adenylation of the 3′ ends of the DNA fragments, Illumina PE adapter oligonucleotides were ligated to prepare for hybridization. The library fragments were purified using the AMPure XP system (Beckman Coulter,Beverly, CA, USA). DNA fragments with ligated adaptor molecules on both ends were selectively enriched using Illumina PCR Primer Cocktail in a 15 cycle PCR reaction. Products were purified (AMPure XP system) and quantified using the Agilent high sensitivity DNA assay on a Bioanalyzer 2100 system (Agilent). The sequencing library was then sequenced on a HiSeq platform (Illumina) by Seqhealth Technology Co., Ltd., Wuhan, China. Differentially expressed genes were then identified by applying a FDR cutoff of 0.05.
Gene function annotation and pathway analysis
Identification of enriched KEGG pathways in the upregulated and downregulated gene lists was performed with DAVID (Database for Annotation, Visualization, and Integrated Discovery) v6.8. Pathway analysis was performed using Ingenuity Pathway Analysis (IPA), version to infer the functional roles and relationships of the differentially expressed genes based on the log2 fold-change value of each gene.
Cell transfection
The mimic of miR-378b as well as negative control (NC mimic) were purchased from Invitrogen (Carlsbad, CA, USA). The full length of SNHG10 was ligated in pcDNA3.1 vector (pcDNA3.1SNHG10) was purchased from GenePharma (Shanghai, China) with empty plasmid as negative control (pcDNA3.1). Cell transfection was conducted using Lipofectamine 2000 (Thermo Fisher Scientific, Waltham, MA, USA). After 48 h, cells were harvested for following experiments.
Real-Time qPCR analysis
The total RNA was extracted from the SK-OV-3 cells by using the commercial TRIzol reagent (Invitrogen, USA) following the manufacturer’s instruction. The quality of the total RNA was determined by agarose electrophoresis, and the RNA was reversely transcribed into complementary DNA (cDNA) by using the TIANScript RT kit (Tiangen Biotech, China). Then, the SYBR Premix Ex Taq TM II Kit (Takara, Japan) was used to determine relative gene expression levels and enrichment. The up-primer sequences for linc00598 is CCTCCCCTACTATCAACATCCC and down primer is TGCCAAGAACGAGCCCTA. The expression levels were normalized by GAPDH (up primer CAATGCCTCCTGCACCACCAACTGC and down primer GCAGTTGGTGGTGCAGGAGGCATTG )
Western blot
Total tissues or cellular proteins were extracted using high performance radio immunoprecipitation analysis lysis buffer (C0481, Sigma-Aldrich) containing 1% protease inhibitor and 1% phosphatase inhibitor (Beyotime). The protein concentration of each sample was determined by a bicinchoninic acid kit (23227, Thermo Fisher Scientific). The proteins were separated by polyacrylamide gel electrophoresis and transferred to polyvinylidene fluoride membranes (Millipore, Billerica, MA, USA) which were blocked with 5% bovine serum albumin (BSA) at room temperature for 1 h. Primary antibodies including rabbit anti-Beclin-1 (1:1000, 3495, CST) rabbit anti-LC3ⅠandⅡ (1:1000, 4108, CST), and rabbit anti-GAPDH (1:3000, a5174, CST) were incubated with membranes overnight at 4°C. On the second day, the membranes were washed with TBST, and incubated with horseradish peroxide (HRP)-labeled goat anti-rabbit immunoglobulin G (IgG; 1:20000, ab205718, Abcam) dilutions at room temperature for 1.5 h. After incubation, the membranes were developed by developing liquid (NCI4106, Pierce, Rockford, IL, USA).
Statistical analysis
Statistical analyses of data were performed using Graphpad Prism 8.0 (GraphPad Software, San Diego, CA, USA). The measurement data were expressed as mean ± standard deviation. Independent sample t test were used in comparisons between groups, and one-way analysis of variance (ANOVA) was used for comparison among multiple groups, followed by Tukey's post hoc tests. Comparison of data between groups at different time points was performed using two-way ANOVA. A p < 0.05 indicated statistically significant.